Rroxscaffold_5G00333500

LRR receptor-like serine threonine-protein kinase At1g29720

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
N/A
Physical Location & Seq
Forward (+)
963483 .. 971581
8099 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00333500.1

Sequence Viewer

Length: 522 bp
ATGGGGCTCTATGGACTACTCCTAAAGGACCTAAACCAAACTAAACCACAAATATTAGGTCCAGGAAACGATCAATTGAAACATGATTGGCATGCAAGGCAGAAAATATGTGTGGATGTGGCAAAAGGTTTAGCTTTTCTCCATGAGGGGTCAACACTGAAAGTGGTACACGGGGACATCAAGGTTGCAAACATACTGCTTGACAGGGACTTCAAAGCAAAAATCTCCAACTTTGGACCATGGCCAAACCTGAGATTTTTAGCCTTCTCCATGGAGCAGAAAATATGTGTGGATGTGGCAAAAGGTTTAGCTTTTCTCCATGAGGGGTCACCACTGAAAGTGTTACACGGGGACATCAAGGTTGCAAACATACTGCTTGACAGGGACTTCAAAGCAAAAATCCCCAACTTTGGATCAGGGCCAAACTTGAGATTTTTAGCCTTGAGTCGAACTTTAAAAGTTCGACCTCTAATCACACATTTCAATTTCAAATGCACAAGTTGGAAGCCCTCTCATGCATGA

Protein Analysis

173

Amino Acids

19.37

Weight (kDa)

9.8

Isoelectric Point (pI)

10.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 27 - 79 1.2e-07 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 32 - 79 7.6e-08 Protein kinase domain
Pkinase PF00069 93 - 140 5.4e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 421
AcoI YGGCCR 1 cut(s) 242
AfaI GTAC 1 cut(s) 168
AfiI CCNNNNNNNGG 1 cut(s) 410
AgsI TTSAA 5 cut(s) 79, 214, 391, 484, 490
AjnI CCWGG 1 cut(s) 61
AluBI AGCT 2 cut(s) 134, 311
AluI AGCT 2 cut(s) 134, 311
AlwI GGATC 1 cut(s) 421
AoxI GGCC 2 cut(s) 242, 419
ArsI GACNNNNNNTTYG 2 cut(s) 43, 75
AspS9I GGNCC 4 cut(s) 28, 59, 236, 419
AsuHPI GGTGA 1 cut(s) 321
AvaII GGWCC 3 cut(s) 28, 59, 236
BalI TGGCCA 1 cut(s) 244
BanII GRGCYC 1 cut(s) 9
BciT130I CCWGG 1 cut(s) 63
Bme1390I CCNGG 1 cut(s) 63
Bme18I GGWCC 3 cut(s) 28, 59, 236
BmgT120I GGNCC 4 cut(s) 28, 59, 236, 419
BmrFI CCNGG 1 cut(s) 63
BpuEI CTTGAG 2 cut(s) 448, 463
BsaJI CCNNGG 2 cut(s) 239, 270
Bsc4I CCNNNNNNNGG 1 cut(s) 410
BseBI CCWGG 1 cut(s) 63
BseDI CCNNGG 2 cut(s) 239, 270
BseGI GGATG 2 cut(s) 121, 298
BseLI CCNNNNNNNGG 1 cut(s) 410
BseMII CTCAG 1 cut(s) 242
BshFI GGCC 2 cut(s) 244, 421
BslFI GGGAC 4 cut(s) 188, 221, 365, 398
BslI CCNNNNNNNGG 1 cut(s) 410
BsmFI GGGAC 4 cut(s) 188, 221, 365, 398
BsnI GGCC 2 cut(s) 244, 421
Bsp1286I GDGCHC 1 cut(s) 9
Bsp143I GATC 2 cut(s) 70, 413
Bsp19I CCATGG 2 cut(s) 239, 270
BspANI GGCC 2 cut(s) 244, 421
BspCNI CTCAG 1 cut(s) 243
BspPI GGATC 1 cut(s) 421
BssECI CCNNGG 2 cut(s) 239, 270
BssMI GATC 2 cut(s) 70, 413
BssT1I CCWWGG 2 cut(s) 239, 270
Bst2UI CCWGG 1 cut(s) 63
BstC8I GCNNGC 1 cut(s) 93
BstDEI CTNAG 1 cut(s) 251
BstDSI CCRYGG 2 cut(s) 239, 270
BstEII GGTNACC 1 cut(s) 327
BstF5I GGATG 2 cut(s) 121, 298
BstKTI GATC 2 cut(s) 73, 416
BstMBI GATC 2 cut(s) 70, 413
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstNI CCWGG 1 cut(s) 63
BstNSI RCATGY 1 cut(s) 95
BstPI GGTNACC 1 cut(s) 327
BstSCI CCNGG 1 cut(s) 61
BsuRI GGCC 2 cut(s) 244, 421
BtgI CCRYGG 2 cut(s) 239, 270
BtsCI GGATG 2 cut(s) 121, 298
BtsIMutI CAGTG 2 cut(s) 155, 332
Cac8I GCNNGC 1 cut(s) 93
Cfr13I GGNCC 4 cut(s) 28, 59, 236, 419
Csp6I GTAC 1 cut(s) 167
CviAII CATG 8 cut(s) 83, 92, 143, 240, 271, 320, 515, 519
CviJI RGCY 8 cut(s) 7, 134, 244, 263, 311, 421, 440, 508
CviKI_1 RGCY 8 cut(s) 7, 134, 244, 263, 311, 421, 440, 508
CviQI GTAC 1 cut(s) 167
DdeI CTNAG 1 cut(s) 251
DpnI GATC 2 cut(s) 72, 415
DpnII GATC 2 cut(s) 70, 413
DraI TTTAAA 1 cut(s) 456
EaeI YGGCCR 1 cut(s) 242
Eco130I CCWWGG 2 cut(s) 239, 270
Eco24I GRGCYC 1 cut(s) 9
Eco47I GGWCC 3 cut(s) 28, 59, 236
Eco91I GGTNACC 1 cut(s) 327
EcoO109I RGGNCCY 1 cut(s) 28
EcoO65I GGTNACC 1 cut(s) 327
EcoRII CCWGG 1 cut(s) 61
EcoT14I CCWWGG 2 cut(s) 239, 270
EcoT22I ATGCAT 1 cut(s) 520
EcoT38I GRGCYC 1 cut(s) 9
ErhI CCWWGG 2 cut(s) 239, 270
FaeI CATG 8 cut(s) 86, 95, 146, 243, 274, 323, 518, 522
FaqI GGGAC 4 cut(s) 188, 221, 365, 398
FatI CATG 8 cut(s) 82, 91, 142, 239, 270, 319, 514, 518
FokI GGATG 2 cut(s) 128, 305
FriOI GRGCYC 1 cut(s) 9
HaeIII GGCC 2 cut(s) 244, 421
Hin1II CATG 8 cut(s) 86, 95, 146, 243, 274, 323, 518, 522
HincII GTYRAC 1 cut(s) 153
HindII GTYRAC 1 cut(s) 153
HinfI GANTC 1 cut(s) 445
HphI GGTGA 1 cut(s) 321
Hpy166II GTNNAC 2 cut(s) 153, 169
Hpy8I GTNNAC 2 cut(s) 153, 169
HpyAV CCTTC 1 cut(s) 274
HpyCH4V TGCA 5 cut(s) 95, 188, 365, 495, 518
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpyF3I CTNAG 1 cut(s) 251
Hsp92II CATG 8 cut(s) 86, 95, 146, 243, 274, 323, 518, 522
Kzo9I GATC 2 cut(s) 70, 413
LmnI GCTCC 1 cut(s) 274
LpnPI CCDG 6 cut(s) 48, 75, 190, 263, 367, 402
MaeIII GTNAC 2 cut(s) 327, 342
MalI GATC 2 cut(s) 72, 415
MboI GATC 2 cut(s) 70, 413
MfeI CAATTG 1 cut(s) 74
MhlI GDGCHC 1 cut(s) 9
MlsI TGGCCA 1 cut(s) 244
MluCI AATT 2 cut(s) 74, 484
MluNI TGGCCA 1 cut(s) 244
MlyI GAGTC 1 cut(s) 454
MmeI TCCRAC 2 cut(s) 252, 482
MnlI CCTC 4 cut(s) 139, 316, 477, 520
Mox20I TGGCCA 1 cut(s) 244
Mph1103I ATGCAT 1 cut(s) 520
MscI TGGCCA 1 cut(s) 244
MseI TTAA 1 cut(s) 455
Msp20I TGGCCA 1 cut(s) 244
MspR9I CCNGG 1 cut(s) 63
MunI CAATTG 1 cut(s) 74
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 97
NcoI CCATGG 2 cut(s) 239, 270
NdeII GATC 2 cut(s) 70, 413
NlaIII CATG 8 cut(s) 86, 95, 146, 243, 274, 323, 518, 522
NmuCI GTSAC 1 cut(s) 327
NsiI ATGCAT 1 cut(s) 520
NspI RCATGY 1 cut(s) 95
PaeI GCATGC 1 cut(s) 95
PfoI TCCNGGA 1 cut(s) 61
PleI GAGTC 1 cut(s) 453
PpsI GAGTC 1 cut(s) 453
PpuMI RGGWCCY 1 cut(s) 28
Psp5II RGGWCCY 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 61
PspEI GGTNACC 1 cut(s) 327
PspGI CCWGG 1 cut(s) 61
PspPI GGNCC 4 cut(s) 28, 59, 236, 419
PspPPI RGGWCCY 1 cut(s) 28
RsaI GTAC 1 cut(s) 168
RsaNI GTAC 1 cut(s) 167
SaqAI TTAA 1 cut(s) 455
Sau3AI GATC 2 cut(s) 70, 413
Sau96I GGNCC 4 cut(s) 28, 59, 236, 419
SchI GAGTC 1 cut(s) 454
ScrFI CCNGG 1 cut(s) 63
SduI GDGCHC 1 cut(s) 9
SinI GGWCC 3 cut(s) 28, 59, 236
SmlI CTYRAG 2 cut(s) 427, 442
SmoI CTYRAG 2 cut(s) 427, 442
SphI GCATGC 1 cut(s) 95
Sse9I AATT 2 cut(s) 74, 484
SspI AATATT 1 cut(s) 54
StyD4I CCNGG 1 cut(s) 61
StyI CCWWGG 2 cut(s) 239, 270
TaqI TCGA 2 cut(s) 448, 463
TasI AATT 2 cut(s) 74, 484
Tru1I TTAA 1 cut(s) 455
Tru9I TTAA 1 cut(s) 455
TscAI CASTG 2 cut(s) 162, 339
TseFI GTSAC 1 cut(s) 327
Tsp45I GTSAC 1 cut(s) 327
TspRI CASTG 2 cut(s) 162, 339
VpaK11BI GGWCC 3 cut(s) 28, 59, 236
XceI RCATGY 1 cut(s) 95
Zsp2I ATGCAT 1 cut(s) 520
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.