Rroxscaffold_5G00350500

F-box FBD LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
N/A
Physical Location & Seq
Forward (+)
24593193 .. 24595918
2726 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00350500.1

Sequence Viewer

Length: 312 bp
ATGTTTGTATTCCCGCCAAGATATTACATCTCGCACTTTATGTGGTTGCTTGCTAGATCCGCCTCCTACATTCGGAGGATTCGTTTTTTTGATGATGTTACTCTCAAGAATACCTCAAACCTTACTGATATTACCATTTCTATGTGTGAACGAAGTTTTGCTGGTGGTGGTTCTAGTAATTTGGTCAAGTTTTTCGGTGACCTGCCTCGAATTCGAAGGCTCACAATTCAGAATTACTTTTTAAAGATTTGGGCATTGGAGTACATTCCAGGATTTGCAAGCATCTTTTTCAGTAATAAAAACGAAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

103

Amino Acids

12.12

Weight (kDa)

9.91

Isoelectric Point (pI)

37.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 210
AciI CCGC 2 cut(s) 14, 60
AclWI GGATC 1 cut(s) 51
AcsI RAATTY 1 cut(s) 210
AfaI GTAC 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 72
AjnI CCWGG 1 cut(s) 268
AlwI GGATC 1 cut(s) 51
ApoI RAATTY 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 209
AsuII TTCGAA 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 270
BfaI CTAG 2 cut(s) 54, 174
BfuAI ACCTGC 1 cut(s) 210
Bme1390I CCNGG 1 cut(s) 270
BmrFI CCNGG 1 cut(s) 270
BmsI GCATC 1 cut(s) 291
Bpu14I TTCGAA 1 cut(s) 214
BpuEI CTTGAG 1 cut(s) 89
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
Bsc4I CCNNNNNNNGG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 270
BseLI CCNNNNNNNGG 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 72
Bsp119I TTCGAA 1 cut(s) 214
Bsp143I GATC 1 cut(s) 56
BspACI CCGC 2 cut(s) 14, 60
BspMI ACCTGC 1 cut(s) 210
BspPI GGATC 1 cut(s) 51
BspT104I TTCGAA 1 cut(s) 214
BssMI GATC 1 cut(s) 56
Bst2UI CCWGG 1 cut(s) 270
BstBI TTCGAA 1 cut(s) 214
BstC8I GCNNGC 2 cut(s) 51, 280
BstEII GGTNACC 1 cut(s) 197
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 59
BstNI CCWGG 1 cut(s) 270
BstPI GGTNACC 1 cut(s) 197
BstSCI CCNGG 1 cut(s) 268
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BveI ACCTGC 1 cut(s) 210
Cac8I GCNNGC 2 cut(s) 51, 280
Csp6I GTAC 1 cut(s) 262
CviJI RGCY 1 cut(s) 220
CviKI_1 RGCY 1 cut(s) 220
CviQI GTAC 1 cut(s) 262
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
DraI TTTAAA 1 cut(s) 243
EciI GGCGGA 1 cut(s) 49
Eco91I GGTNACC 1 cut(s) 197
EcoO65I GGTNACC 1 cut(s) 197
EcoRI GAATTC 1 cut(s) 210
EcoRII CCWGG 1 cut(s) 268
FaiI YATR 2 cut(s) 41, 143
FauI CCCGC 1 cut(s) 21
FspBI CTAG 2 cut(s) 54, 174
HinfI GANTC 1 cut(s) 79
HphI GGTGA 1 cut(s) 209
Hpy166II GTNNAC 1 cut(s) 149
Hpy188I TCNGA 2 cut(s) 75, 231
Hpy188III TCNNGA 1 cut(s) 106
Hpy8I GTNNAC 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 210
HpyCH4V TGCA 1 cut(s) 278
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
Kzo9I GATC 1 cut(s) 56
LpnPI CCDG 4 cut(s) 147, 215, 255, 282
LweI GCATC 1 cut(s) 291
MaeI CTAG 2 cut(s) 54, 174
MaeIII GTNAC 2 cut(s) 97, 197
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MflI RGATCY 1 cut(s) 56
MluCI AATT 4 cut(s) 178, 210, 225, 232
MnlI CCTC 4 cut(s) 69, 73, 124, 216
MseI TTAA 1 cut(s) 242
MslI CAYNNNNRTG 1 cut(s) 140
MspR9I CCNGG 1 cut(s) 270
MvaI CCWGG 1 cut(s) 270
MwoI GCNNNNNNNGC 1 cut(s) 59
NdeII GATC 1 cut(s) 56
NmuCI GTSAC 1 cut(s) 197
NspV TTCGAA 1 cut(s) 214
PcsI WCGNNNNNNNCGW 1 cut(s) 79
PfeI GAWTC 1 cut(s) 79
PfoI TCCNGGA 1 cut(s) 268
Psp6I CCWGG 1 cut(s) 268
PspEI GGTNACC 1 cut(s) 197
PspGI CCWGG 1 cut(s) 268
PsuI RGATCY 1 cut(s) 56
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
RseI CAYNNNNRTG 1 cut(s) 140
SaqAI TTAA 1 cut(s) 242
Sau3AI GATC 1 cut(s) 56
ScrFI CCNGG 1 cut(s) 270
SetI ASST 3 cut(s) 116, 123, 204
SfaNI GCATC 1 cut(s) 291
SfuI TTCGAA 1 cut(s) 214
SmiMI CAYNNNNRTG 1 cut(s) 140
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 4 cut(s) 178, 210, 225, 232
SsiI CCGC 2 cut(s) 14, 60
SspMI CTAG 2 cut(s) 54, 174
StyD4I CCNGG 1 cut(s) 268
TaqI TCGA 2 cut(s) 208, 214
TasI AATT 4 cut(s) 178, 210, 225, 232
TatI WGTACW 1 cut(s) 261
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TseFI GTSAC 1 cut(s) 197
Tsp45I GTSAC 1 cut(s) 197
XapI RAATTY 1 cut(s) 210
XspI CTAG 2 cut(s) 54, 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.