Rroxscaffold_5G00353550

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
N/A
Physical Location & Seq
Reverse (-)
31420124 .. 31427229
7106 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00353550.1

Sequence Viewer

Length: 201 bp
ATGGCTCTATTCTGTCGTTGCCCGGACCCCGGAAAGTCTCACAACCGTTATGTTGGAGTTTGGTACTACCAAGTTTGGAACCAAACAATTGTGTGGGTCGCAAACAGAGATAATCCTGTCAATGATAGCTCTGCTCTCCTAGCGATTCATGGAGGCAGGGGCCTTGTGATCTATGGGAAAGACAAAGAAATCCCTCTTTGA

Protein Analysis

66

Amino Acids

7.5

Weight (kDa)

8.71

Isoelectric Point (pI)

20.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 29 - 62 4e-07 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 65
AfiI CCNNNNNNNGG 1 cut(s) 29
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
Alw26I GTCTC 1 cut(s) 42
AoxI GGCC 1 cut(s) 160
AspS9I GGNCC 2 cut(s) 25, 160
AsuC2I CCSGG 2 cut(s) 23, 30
AvaII GGWCC 1 cut(s) 25
BcnI CCSGG 2 cut(s) 23, 30
BcoDI GTCTC 1 cut(s) 42
BfaI CTAG 1 cut(s) 140
Bme1390I CCNGG 2 cut(s) 23, 30
Bme18I GGWCC 1 cut(s) 25
BmgT120I GGNCC 2 cut(s) 25, 160
BmiI GGNNCC 3 cut(s) 27, 80, 161
BmrFI CCNGG 2 cut(s) 23, 30
BpuMI CCSGG 2 cut(s) 23, 30
BsaJI CCNNGG 1 cut(s) 28
Bsc4I CCNNNNNNNGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 28
BseLI CCNNNNNNNGG 1 cut(s) 29
BshFI GGCC 1 cut(s) 162
BsiSI CCGG 2 cut(s) 23, 30
BslI CCNNNNNNNGG 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 42
BsnI GGCC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 168
BspANI GGCC 1 cut(s) 162
BspLI GGNNCC 3 cut(s) 27, 80, 161
BssECI CCNNGG 1 cut(s) 28
BssMI GATC 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 47
BstKTI GATC 1 cut(s) 171
BstMAI GTCTC 1 cut(s) 42
BstMBI GATC 1 cut(s) 168
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstSCI CCNGG 2 cut(s) 21, 28
BsuRI GGCC 1 cut(s) 162
Cfr13I GGNCC 2 cut(s) 25, 160
Csp6I GTAC 1 cut(s) 64
CviAII CATG 1 cut(s) 149
CviJI RGCY 3 cut(s) 5, 129, 162
CviKI_1 RGCY 3 cut(s) 5, 129, 162
CviQI GTAC 1 cut(s) 64
DpnI GATC 1 cut(s) 170
DpnII GATC 1 cut(s) 168
Eco47I GGWCC 1 cut(s) 25
EcoO109I RGGNCCY 1 cut(s) 160
FaeI CATG 1 cut(s) 152
FaiI YATR 3 cut(s) 51, 150, 174
FatI CATG 1 cut(s) 148
FspBI CTAG 1 cut(s) 140
HaeIII GGCC 1 cut(s) 162
HapII CCGG 2 cut(s) 23, 30
Hin1II CATG 1 cut(s) 152
HinfI GANTC 1 cut(s) 145
HpaII CCGG 2 cut(s) 23, 30
HpyCH4III ACNGT 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
Hsp92II CATG 1 cut(s) 152
Kzo9I GATC 1 cut(s) 168
LpnPI CCDG 4 cut(s) 36, 43, 129, 142
MaeI CTAG 1 cut(s) 140
MalI GATC 1 cut(s) 170
MboI GATC 1 cut(s) 168
MfeI CAATTG 1 cut(s) 87
MluCI AATT 1 cut(s) 87
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 1 cut(s) 146
MspI CCGG 2 cut(s) 23, 30
MspR9I CCNGG 2 cut(s) 23, 30
MunI CAATTG 1 cut(s) 87
MwoI GCNNNNNNNGC 1 cut(s) 140
NciI CCSGG 2 cut(s) 23, 30
NdeII GATC 1 cut(s) 168
NlaIII CATG 1 cut(s) 152
NlaIV GGNNCC 3 cut(s) 27, 80, 161
PfeI GAWTC 1 cut(s) 145
PspN4I GGNNCC 3 cut(s) 27, 80, 161
PspPI GGNCC 2 cut(s) 25, 160
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
Sau3AI GATC 1 cut(s) 168
Sau96I GGNCC 2 cut(s) 25, 160
ScrFI CCNGG 2 cut(s) 23, 30
SetI ASST 1 cut(s) 131
SinI GGWCC 1 cut(s) 25
Sse9I AATT 1 cut(s) 87
SspMI CTAG 1 cut(s) 140
StyD4I CCNGG 2 cut(s) 21, 28
TaaI ACNGT 1 cut(s) 47
TasI AATT 1 cut(s) 87
TfiI GAWTC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 137
VpaK11BI GGWCC 1 cut(s) 25
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.