Rroxscaffold_6G00402810

Male gamete fusion factor

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
N/A
Physical Location & Seq
Forward (+)
25296428 .. 25300778
4351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00402810.1

Sequence Viewer

Length: 360 bp
ATGGAGCAGCAAAAAGAGATGACCATAAAGCAAATTCGCTTCTTCTGGAATTCTCAAAGGTGGCTAATCAAGAAAGGGGCTGAGGCTCGTGAAGGGGCTGAGGCTGAGTTCGGGAAGTATGTGCTTCTTAAGGTTATCAAGATTTATGATCATTCTTTTGTTCAAGCTCGGAGTCCTGGGAAAATCTTAAGCATCAATATCCCAACATTTGAGGCCCTTACTCAATTTGGAACTGCTACAATCACAGCAAAGAATACTGGTGAAGTGGAAGCATCCTATTGCTTAACATCTTCAATTATGACAGTGAGGACTAGGAAGGAAGACATTAGAGCCATAACAAGGATGTCCACTCTGCGGTAA

Protein Analysis

119

Amino Acids

13.65

Weight (kDa)

9.81

Isoelectric Point (pI)

36.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HAP2-GCS1 PF10699 50 - 96 2.1e-11 Male gamete fusion factor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 355
AcsI RAATTY 2 cut(s) 33, 49
AfiI CCNNNNNNNGG 2 cut(s) 339, 354
AflII CTTAAG 2 cut(s) 128, 187
AgsI TTSAA 2 cut(s) 164, 294
AjnI CCWGG 1 cut(s) 175
AluBI AGCT 1 cut(s) 167
AluI AGCT 1 cut(s) 167
AoxI GGCC 1 cut(s) 213
ApeKI GCWGC 1 cut(s) 7
ApoI RAATTY 2 cut(s) 33, 49
AspS9I GGNCC 1 cut(s) 214
AsuHPI GGTGA 1 cut(s) 272
BauI CACGAG 1 cut(s) 87
BbsI GAAGAC 1 cut(s) 327
BbvCI CCTCAGC 2 cut(s) 81, 99
BbvI GCAGC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 177
BclI TGATCA 1 cut(s) 148
BfaI CTAG 1 cut(s) 312
BfrI CTTAAG 2 cut(s) 128, 187
BisI GCNGC 1 cut(s) 8
BlsI GCNGC 1 cut(s) 9
Bme1390I CCNGG 1 cut(s) 177
BmgT120I GGNCC 1 cut(s) 214
BmrFI CCNGG 1 cut(s) 177
BmsI GCATC 2 cut(s) 201, 281
BpiI GAAGAC 1 cut(s) 327
Bpu10I CCTNAGC 2 cut(s) 81, 99
BsaJI CCNNGG 1 cut(s) 176
Bsc4I CCNNNNNNNGG 2 cut(s) 339, 354
Bse1I ACTGG 1 cut(s) 262
BseBI CCWGG 1 cut(s) 177
BseDI CCNNGG 1 cut(s) 176
BseGI GGATG 2 cut(s) 272, 348
BseLI CCNNNNNNNGG 2 cut(s) 339, 354
BseMII CTCAG 3 cut(s) 72, 90, 96
BseNI ACTGG 1 cut(s) 262
BseXI GCAGC 1 cut(s) 19
BshFI GGCC 1 cut(s) 215
BslI CCNNNNNNNGG 2 cut(s) 339, 354
BsnI GGCC 1 cut(s) 215
Bsp143I GATC 1 cut(s) 148
BspACI CCGC 1 cut(s) 355
BspANI GGCC 1 cut(s) 215
BspCNI CTCAG 3 cut(s) 73, 91, 97
BspTI CTTAAG 2 cut(s) 128, 187
BsrI ACTGG 1 cut(s) 262
BssECI CCNNGG 1 cut(s) 176
BssMI GATC 1 cut(s) 148
BssSI CACGAG 1 cut(s) 87
Bst2BI CACGAG 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 177
Bst4CI ACNGT 1 cut(s) 304
BstAFI CTTAAG 2 cut(s) 128, 187
BstDEI CTNAG 3 cut(s) 81, 99, 105
BstF5I GGATG 2 cut(s) 272, 348
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 177
BstSCI CCNGG 1 cut(s) 175
BstV1I GCAGC 1 cut(s) 19
BstV2I GAAGAC 1 cut(s) 327
BsuRI GGCC 1 cut(s) 215
BtsCI GGATG 2 cut(s) 272, 348
BtsIMutI CAGTG 1 cut(s) 309
Cfr13I GGNCC 1 cut(s) 214
CviJI RGCY 8 cut(s) 64, 80, 86, 98, 104, 167, 215, 332
CviKI_1 RGCY 8 cut(s) 64, 80, 86, 98, 104, 167, 215, 332
DdeI CTNAG 3 cut(s) 81, 99, 105
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
EcoO109I RGGNCCY 1 cut(s) 214
EcoRI GAATTC 1 cut(s) 49
EcoRII CCWGG 1 cut(s) 175
FaiI YATR 5 cut(s) 26, 120, 147, 299, 335
FbaI TGATCA 1 cut(s) 148
Fnu4HI GCNGC 1 cut(s) 8
FokI GGATG 2 cut(s) 259, 355
Fsp4HI GCNGC 1 cut(s) 8
FspBI CTAG 1 cut(s) 312
GluI GCNGC 1 cut(s) 8
HaeIII GGCC 1 cut(s) 215
HinfI GANTC 1 cut(s) 172
HphI GGTGA 1 cut(s) 272
Hpy166II GTNNAC 1 cut(s) 348
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 5 cut(s) 46, 70, 89, 112, 139
Hpy8I GTNNAC 1 cut(s) 348
HpyAV CCTTC 2 cut(s) 86, 310
HpyCH4III ACNGT 1 cut(s) 304
HpyF3I CTNAG 3 cut(s) 81, 99, 105
Ksp22I TGATCA 1 cut(s) 148
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 4 cut(s) 31, 162, 189, 243
Lsp1109I GCAGC 1 cut(s) 19
LweI GCATC 2 cut(s) 201, 281
MaeI CTAG 1 cut(s) 312
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 3 cut(s) 34, 282, 332
MluCI AATT 4 cut(s) 33, 49, 224, 294
MlyI GAGTC 1 cut(s) 181
MnlI CCTC 4 cut(s) 76, 94, 205, 300
MseI TTAA 3 cut(s) 129, 188, 284
MspCI CTTAAG 2 cut(s) 128, 187
MspR9I CCNGG 1 cut(s) 177
MvaI CCWGG 1 cut(s) 177
NdeII GATC 1 cut(s) 148
PkrI GCNGC 1 cut(s) 9
PleI GAGTC 1 cut(s) 180
PpsI GAGTC 1 cut(s) 180
Psp6I CCWGG 1 cut(s) 175
PspGI CCWGG 1 cut(s) 175
PspPI GGNCC 1 cut(s) 214
SaqAI TTAA 3 cut(s) 129, 188, 284
SatI GCNGC 1 cut(s) 8
Sau3AI GATC 1 cut(s) 148
Sau96I GGNCC 1 cut(s) 214
SchI GAGTC 1 cut(s) 181
ScrFI CCNGG 1 cut(s) 177
SetI ASST 3 cut(s) 62, 135, 169
SfaNI GCATC 2 cut(s) 201, 281
SmlI CTYRAG 2 cut(s) 128, 187
SmoI CTYRAG 2 cut(s) 128, 187
Sse9I AATT 4 cut(s) 33, 49, 224, 294
SsiI CCGC 1 cut(s) 355
SspMI CTAG 1 cut(s) 312
StyD4I CCNGG 1 cut(s) 175
TaaI ACNGT 1 cut(s) 304
TasI AATT 4 cut(s) 33, 49, 224, 294
Tru1I TTAA 3 cut(s) 129, 188, 284
Tru9I TTAA 3 cut(s) 129, 188, 284
TscAI CASTG 1 cut(s) 309
TseI GCWGC 1 cut(s) 7
TspRI CASTG 1 cut(s) 309
Vha464I CTTAAG 2 cut(s) 128, 187
XapI RAATTY 2 cut(s) 33, 49
XspI CTAG 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.