Rroxscaffold_6G00411640

Wall-associated receptor kinase galacturonan-binding

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
N/A
Physical Location & Seq
Reverse (-)
34243401 .. 34245541
2141 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00411640.1

Sequence Viewer

Length: 345 bp
ATGCGAGAGATCGCAGTAGAGTTGGAGGCCATCCAATTATCGGAGAAACTTGGCAACGCTCGTCAACAAAGTTGTGAAATGATTGAATTTGGCCAAGAGTATCGAATCGAGAAGTGGGATGACGTTGTTTCTAGCTCAACAATGTCAAATTGGGAAGGTGCTCGACTCCATCATCGTGTGTTTTGCTTGAGTCAAGTGGACTTTCAAATATTCGGTCTAAGGACCTTTTATCACATTGGTGATCGAGATAAGGGTATCGATGTCATAACCCTAGGCGGTGACGGGCTACGATTGAGGCGAGTGTGTCGATGTCATAACCCTAGGCGTGTGACAGGCTACGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

114

Amino Acids

13.26

Weight (kDa)

6.42

Isoelectric Point (pI)

61.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 276
AcoI YGGCCR 1 cut(s) 91
AcsI RAATTY 1 cut(s) 86
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 2 cut(s) 86, 206
AleI CACNNNNGTG 1 cut(s) 237
AluBI AGCT 1 cut(s) 135
AluI AGCT 1 cut(s) 135
Alw21I GWGCWC 1 cut(s) 163
AoxI GGCC 2 cut(s) 27, 91
ApoI RAATTY 1 cut(s) 86
ArsI GACNNNNNNTTYG 2 cut(s) 199, 231
AspA2I CCTAGG 2 cut(s) 271, 320
AspS9I GGNCC 1 cut(s) 222
AsuHPI GGTGA 2 cut(s) 251, 290
AvaII GGWCC 1 cut(s) 222
AvrII CCTAGG 2 cut(s) 271, 320
BalI TGGCCA 1 cut(s) 93
Bbv12I GWGCWC 1 cut(s) 163
BccI CCATC 2 cut(s) 38, 177
BfaI CTAG 3 cut(s) 132, 272, 321
BlnI CCTAGG 2 cut(s) 271, 320
Bme18I GGWCC 1 cut(s) 222
BmgT120I GGNCC 1 cut(s) 222
BpuEI CTTGAG 1 cut(s) 208
Bsa29I ATCGAT 1 cut(s) 258
BsaJI CCNNGG 2 cut(s) 271, 320
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseCI ATCGAT 1 cut(s) 258
BseDI CCNNGG 2 cut(s) 271, 320
BseGI GGATG 2 cut(s) 30, 124
BseLI CCNNNNNNNGG 1 cut(s) 40
BshFI GGCC 2 cut(s) 29, 93
BshVI ATCGAT 1 cut(s) 258
BsiHKAI GWGCWC 1 cut(s) 163
BslI CCNNNNNNNGG 1 cut(s) 40
BsnI GGCC 2 cut(s) 29, 93
Bsp1286I GDGCHC 1 cut(s) 163
Bsp143I GATC 2 cut(s) 9, 241
BspACI CCGC 1 cut(s) 276
BspANI GGCC 2 cut(s) 29, 93
BspDI ATCGAT 1 cut(s) 258
BssECI CCNNGG 2 cut(s) 271, 320
BssMI GATC 2 cut(s) 9, 241
BssT1I CCWWGG 2 cut(s) 271, 320
BstDEI CTNAG 1 cut(s) 218
BstF5I GGATG 2 cut(s) 30, 124
BstKTI GATC 2 cut(s) 12, 244
BstMBI GATC 2 cut(s) 9, 241
Bsu15I ATCGAT 1 cut(s) 258
BsuRI GGCC 2 cut(s) 29, 93
BsuTUI ATCGAT 1 cut(s) 258
BtsCI GGATG 2 cut(s) 30, 124
Cfr13I GGNCC 1 cut(s) 222
ClaI ATCGAT 1 cut(s) 258
CviJI RGCY 5 cut(s) 29, 93, 135, 286, 336
CviKI_1 RGCY 5 cut(s) 29, 93, 135, 286, 336
DdeI CTNAG 1 cut(s) 218
DpnI GATC 2 cut(s) 11, 243
DpnII GATC 2 cut(s) 9, 241
EaeI YGGCCR 1 cut(s) 91
Eco130I CCWWGG 2 cut(s) 271, 320
Eco47I GGWCC 1 cut(s) 222
EcoO109I RGGNCCY 1 cut(s) 222
EcoT14I CCWWGG 2 cut(s) 271, 320
ErhI CCWWGG 2 cut(s) 271, 320
FaiI YATR 2 cut(s) 266, 315
FokI GGATG 2 cut(s) 17, 131
FspBI CTAG 3 cut(s) 132, 272, 321
HaeIII GGCC 2 cut(s) 29, 93
HincII GTYRAC 1 cut(s) 65
HindII GTYRAC 1 cut(s) 65
HinfI GANTC 3 cut(s) 105, 165, 190
HphI GGTGA 2 cut(s) 251, 290
Hpy166II GTNNAC 2 cut(s) 65, 199
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 2 cut(s) 109, 245
Hpy8I GTNNAC 2 cut(s) 65, 199
HpyAV CCTTC 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 123
HpyF3I CTNAG 1 cut(s) 218
HpySE526I ACGT 1 cut(s) 123
Kzo9I GATC 2 cut(s) 9, 241
LpnPI CCDG 1 cut(s) 318
MaeI CTAG 3 cut(s) 132, 272, 321
MaeII ACGT 1 cut(s) 123
MaeIII GTNAC 2 cut(s) 278, 328
MalI GATC 2 cut(s) 11, 243
MboI GATC 2 cut(s) 9, 241
MhlI GDGCHC 1 cut(s) 163
MlsI TGGCCA 1 cut(s) 93
MluCI AATT 3 cut(s) 35, 86, 148
MluNI TGGCCA 1 cut(s) 93
MlyI GAGTC 2 cut(s) 159, 199
MnlI CCTC 2 cut(s) 19, 288
Mox20I TGGCCA 1 cut(s) 93
MscI TGGCCA 1 cut(s) 93
MslI CAYNNNNRTG 2 cut(s) 174, 237
Msp20I TGGCCA 1 cut(s) 93
NdeII GATC 2 cut(s) 9, 241
NmuCI GTSAC 2 cut(s) 278, 328
OliI CACNNNNGTG 1 cut(s) 237
PcsI WCGNNNNNNNCGW 1 cut(s) 295
PfeI GAWTC 1 cut(s) 105
PleI GAGTC 2 cut(s) 159, 198
PpsI GAGTC 2 cut(s) 159, 198
PpuMI RGGWCCY 1 cut(s) 222
Psp5II RGGWCCY 1 cut(s) 222
PspPI GGNCC 1 cut(s) 222
PspPPI RGGWCCY 1 cut(s) 222
RseI CAYNNNNRTG 2 cut(s) 174, 237
Sau3AI GATC 2 cut(s) 9, 241
Sau96I GGNCC 1 cut(s) 222
SchI GAGTC 2 cut(s) 159, 199
SduI GDGCHC 1 cut(s) 163
SetI ASST 4 cut(s) 126, 137, 160, 227
SinI GGWCC 1 cut(s) 222
SmiMI CAYNNNNRTG 2 cut(s) 174, 237
SmlI CTYRAG 1 cut(s) 187
SmoI CTYRAG 1 cut(s) 187
Sse9I AATT 3 cut(s) 35, 86, 148
SsiI CCGC 1 cut(s) 276
SspI AATATT 1 cut(s) 210
SspMI CTAG 3 cut(s) 132, 272, 321
StyI CCWWGG 2 cut(s) 271, 320
TaiI ACGT 1 cut(s) 126
TaqI TCGA 6 cut(s) 103, 108, 163, 244, 258, 307
TaqII GACCGA 1 cut(s) 203
TasI AATT 3 cut(s) 35, 86, 148
TfiI GAWTC 1 cut(s) 105
TseFI GTSAC 2 cut(s) 278, 328
Tsp45I GTSAC 2 cut(s) 278, 328
VpaK11BI GGWCC 1 cut(s) 222
XapI RAATTY 1 cut(s) 86
XmaJI CCTAGG 2 cut(s) 271, 320
XspI CTAG 3 cut(s) 132, 272, 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.