Rroxscaffold_6G00411650

Wall-associated receptor kinase galacturonan-binding

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
N/A
Physical Location & Seq
Reverse (-)
34245857 .. 34246445
589 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00411650.1

Sequence Viewer

Length: 504 bp
ATGTTTTACAAACGAAATGGTGGTTTATTGCTAGAACAACAATTATCGTCAGGTGATATTAACGTTGAGAGAATCAAATTGTTCAAATGCAAGGAGTTACAGAGGTCTACAAACAATTTCAATGCTGATAGAATTATTGGCCAAGGGGGCAAGTTCATCAATGAGATCGTCATTCTTTCTCAAATCAACCACAGGAATATCGTTCAACTATTGGGTTGTTGTCTAGAGACAGAAGTTCCTCTTTTGGTATATGAGTTTATACCTAACGGAAACTTATCTCGGTACATCCATGAGCAGACCGAAGTATTTCCACTTACATGGGAGATTCGTTTACGAATTGCTACGAAATTGCAGGAGCTCTTTCCTACTTACATGCTTCAGCTTCGTTTCCCATTTATCACAGAGACATCAAGTCCACAAACATACTCTTGGATGATAAATACAGAGCAAAAATTGCTGACTTTGGAACTTCAAGATTTGTTGCCATTGACCAGACTCACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

167

Amino Acids

19.55

Weight (kDa)

6.74

Isoelectric Point (pI)

55.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 28 - 100 6.9e-07 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 50 - 110 4.5e-11 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 107
AclI AACGTT 1 cut(s) 63
AcoI YGGCCR 1 cut(s) 139
AcuI CTGAAG 1 cut(s) 362
AfaI GTAC 1 cut(s) 284
AgsI TTSAA 4 cut(s) 85, 121, 206, 473
AhdI GACNNNNNGTC 1 cut(s) 411
AluBI AGCT 2 cut(s) 358, 382
AluI AGCT 2 cut(s) 358, 382
Alw21I GWGCWC 1 cut(s) 360
Alw26I GTCTC 2 cut(s) 221, 398
AoxI GGCC 1 cut(s) 139
Asp700I GAANNNNTTC 1 cut(s) 306
AsuHPI GGTGA 1 cut(s) 65
BalI TGGCCA 1 cut(s) 141
BanII GRGCYC 1 cut(s) 360
Bbv12I GWGCWC 1 cut(s) 360
BcoDI GTCTC 2 cut(s) 221, 398
BfaI CTAG 2 cut(s) 32, 224
BglI GCCNNNNNGGC 1 cut(s) 147
BmeRI GACNNNNNGTC 1 cut(s) 411
BsaJI CCNNGG 1 cut(s) 142
BseDI CCNNGG 1 cut(s) 142
BseGI GGATG 2 cut(s) 285, 438
BshFI GGCC 1 cut(s) 141
BsiHKAI GWGCWC 1 cut(s) 360
BsmAI GTCTC 2 cut(s) 221, 398
BsnI GGCC 1 cut(s) 141
Bsp1286I GDGCHC 1 cut(s) 360
Bsp143I GATC 1 cut(s) 165
BspANI GGCC 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 1 cut(s) 165
BssT1I CCWWGG 1 cut(s) 142
BstAPI GCANNNNNTGC 1 cut(s) 454
BstF5I GGATG 2 cut(s) 285, 438
BstKTI GATC 1 cut(s) 168
BstMAI GTCTC 2 cut(s) 221, 398
BstMBI GATC 1 cut(s) 165
BstMWI GCNNNNNNNGC 2 cut(s) 147, 454
BstNSI RCATGY 1 cut(s) 376
BstXI CCANNNNNNTGG 1 cut(s) 318
BsuRI GGCC 1 cut(s) 141
BtsCI GGATG 2 cut(s) 285, 438
Csp6I GTAC 1 cut(s) 283
CviAII CATG 3 cut(s) 290, 318, 373
CviJI RGCY 3 cut(s) 141, 358, 382
CviKI_1 RGCY 3 cut(s) 141, 358, 382
CviQI GTAC 1 cut(s) 283
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
DriI GACNNNNNGTC 1 cut(s) 411
EaeI YGGCCR 1 cut(s) 139
Eam1105I GACNNNNNGTC 1 cut(s) 411
Ecl136II GAGCTC 1 cut(s) 358
Eco130I CCWWGG 1 cut(s) 142
Eco24I GRGCYC 1 cut(s) 360
Eco53kI GAGCTC 1 cut(s) 358
Eco57I CTGAAG 1 cut(s) 362
EcoICRI GAGCTC 1 cut(s) 358
EcoT14I CCWWGG 1 cut(s) 142
EcoT38I GRGCYC 1 cut(s) 360
ErhI CCWWGG 1 cut(s) 142
FaeI CATG 3 cut(s) 293, 321, 376
FaiI YATR 7 cut(s) 250, 252, 260, 291, 319, 374, 424
FalI AAGNNNNNCTT 2 cut(s) 225, 257
FatI CATG 3 cut(s) 289, 317, 372
FblI GTMKAC 1 cut(s) 107
FokI GGATG 2 cut(s) 272, 445
FriOI GRGCYC 1 cut(s) 360
FspBI CTAG 2 cut(s) 32, 224
HaeIII GGCC 1 cut(s) 141
Hin1II CATG 3 cut(s) 293, 321, 376
HinfI GANTC 3 cut(s) 72, 325, 495
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 3 cut(s) 108, 332, 416
Hpy188III TCNNGA 2 cut(s) 224, 473
Hpy8I GTNNAC 3 cut(s) 108, 332, 416
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 2 cut(s) 90, 352
HpyF10VI GCNNNNNNNGC 2 cut(s) 147, 454
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 3 cut(s) 293, 321, 376
Kzo9I GATC 1 cut(s) 165
LmnI GCTCC 1 cut(s) 355
LpnPI CCDG 3 cut(s) 36, 178, 338
MaeI CTAG 2 cut(s) 32, 224
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 96
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MhlI GDGCHC 1 cut(s) 360
MlsI TGGCCA 1 cut(s) 141
MluCI AATT 7 cut(s) 41, 77, 115, 132, 336, 347, 452
MluNI TGGCCA 1 cut(s) 141
MlyI GAGTC 1 cut(s) 489
MnlI CCTC 2 cut(s) 96, 249
Mox20I TGGCCA 1 cut(s) 141
MroXI GAANNNNTTC 1 cut(s) 306
MscI TGGCCA 1 cut(s) 141
MseI TTAA 1 cut(s) 60
MslI CAYNNNNRTG 1 cut(s) 316
Msp20I TGGCCA 1 cut(s) 141
MwoI GCNNNNNNNGC 2 cut(s) 147, 454
NdeII GATC 1 cut(s) 165
NlaIII CATG 3 cut(s) 293, 321, 376
NspI RCATGY 1 cut(s) 376
PdmI GAANNNNTTC 1 cut(s) 306
PfeI GAWTC 2 cut(s) 72, 325
PleI GAGTC 1 cut(s) 489
PpsI GAGTC 1 cut(s) 489
Psp124BI GAGCTC 1 cut(s) 360
Psp1406I AACGTT 1 cut(s) 63
RsaI GTAC 1 cut(s) 284
RsaNI GTAC 1 cut(s) 283
RseI CAYNNNNRTG 1 cut(s) 316
SacI GAGCTC 1 cut(s) 360
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 1 cut(s) 165
SchI GAGTC 1 cut(s) 489
SduI GDGCHC 1 cut(s) 360
SetI ASST 6 cut(s) 55, 66, 107, 265, 360, 384
SmiMI CAYNNNNRTG 1 cut(s) 316
Sse9I AATT 7 cut(s) 41, 77, 115, 132, 336, 347, 452
SspMI CTAG 2 cut(s) 32, 224
SstI GAGCTC 1 cut(s) 360
StyI CCWWGG 1 cut(s) 142
TaiI ACGT 1 cut(s) 66
TaqII GACCGA 1 cut(s) 314
TasI AATT 7 cut(s) 41, 77, 115, 132, 336, 347, 452
TfiI GAWTC 2 cut(s) 72, 325
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TspDTI ATGAA 1 cut(s) 145
TspGWI ACGGA 1 cut(s) 282
XbaI TCTAGA 1 cut(s) 223
XceI RCATGY 1 cut(s) 376
XmiI GTMKAC 1 cut(s) 107
XmnI GAANNNNTTC 1 cut(s) 306
XspI CTAG 2 cut(s) 32, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.