Rroxscaffold_6G00423650
HSP70 Family

Belongs to the heat shock protein 70 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
N/A
Physical Location & Seq
Forward (+)
44703639 .. 44705798
2160 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00423650.1

Sequence Viewer

Length: 273 bp
ATGGTTGTCGTCGGTTCGTTGTTGCCTCGTAAGGTTGTGAACATAGATGGGAAGCCTTATATTCAGGTGAAGTTTAGAGGTGAAATCAAGGTGTTTAGCCCTGAGAAAATCAGTGCTATGATATTGACTAAGAAGATCAAAGACGCTCTCATAACTGTTCCAGGTAATCACCAGTTCTCTGTGGAGATTGAGTCTCTTTTCGATGGTACTGATTTCTCGAAGTCATTGACAAGGGAGAGGTTTGAGGAGGACCATGGGGATAGTGGAAATTAA

Protein Analysis

90

Amino Acids

10.08

Weight (kDa)

6.73

Isoelectric Point (pI)

30.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 208
AjnI CCWGG 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 198
AspS9I GGNCC 1 cut(s) 250
AsuHPI GGTGA 3 cut(s) 79, 92, 161
AvaII GGWCC 1 cut(s) 250
BccI CCATC 2 cut(s) 41, 197
BciT130I CCWGG 1 cut(s) 162
BcoDI GTCTC 1 cut(s) 198
Bme1390I CCNGG 1 cut(s) 162
Bme18I GGWCC 1 cut(s) 250
BmgT120I GGNCC 1 cut(s) 250
BmrFI CCNGG 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 253
BsaXI ACNNNNNCTCC 2 cut(s) 176, 206
Bse1I ACTGG 1 cut(s) 172
BseBI CCWGG 1 cut(s) 162
BseDI CCNNGG 1 cut(s) 253
BseMII CTCAG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 172
BseRI GAGGAG 1 cut(s) 260
BsmAI GTCTC 1 cut(s) 198
Bsp143I GATC 1 cut(s) 135
Bsp19I CCATGG 1 cut(s) 253
BspCNI CTCAG 1 cut(s) 94
BsrI ACTGG 1 cut(s) 172
BssECI CCNNGG 1 cut(s) 253
BssMI GATC 1 cut(s) 135
BssT1I CCWWGG 1 cut(s) 253
Bst2UI CCWGG 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 157
BstDEI CTNAG 2 cut(s) 102, 129
BstDSI CCRYGG 1 cut(s) 253
BstKTI GATC 1 cut(s) 138
BstMAI GTCTC 1 cut(s) 198
BstMBI GATC 1 cut(s) 135
BstNI CCWGG 1 cut(s) 162
BstSCI CCNGG 1 cut(s) 160
BtgI CCRYGG 1 cut(s) 253
BtsIMutI CAGTG 1 cut(s) 118
Cfr13I GGNCC 1 cut(s) 250
CseI GACGC 1 cut(s) 152
Csp6I GTAC 1 cut(s) 207
CviAII CATG 1 cut(s) 254
CviJI RGCY 2 cut(s) 55, 99
CviKI_1 RGCY 2 cut(s) 55, 99
CviQI GTAC 1 cut(s) 207
DdeI CTNAG 2 cut(s) 102, 129
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
Eco130I CCWWGG 1 cut(s) 253
Eco47I GGWCC 1 cut(s) 250
EcoRII CCWGG 1 cut(s) 160
EcoT14I CCWWGG 1 cut(s) 253
ErhI CCWWGG 1 cut(s) 253
FaeI CATG 1 cut(s) 257
FaiI YATR 5 cut(s) 44, 60, 119, 152, 255
FatI CATG 1 cut(s) 253
HgaI GACGC 1 cut(s) 152
Hin1II CATG 1 cut(s) 257
HinfI GANTC 1 cut(s) 191
HphI GGTGA 3 cut(s) 79, 92, 161
Hpy166II GTNNAC 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 217
Hpy8I GTNNAC 1 cut(s) 40
Hpy99I CGWCG 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 157
HpyF3I CTNAG 2 cut(s) 102, 129
Hsp92II CATG 1 cut(s) 257
Kzo9I GATC 1 cut(s) 135
LpnPI CCDG 5 cut(s) 50, 114, 147, 174, 185
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MboII GAAGA 1 cut(s) 145
MluCI AATT 1 cut(s) 268
MlyI GAGTC 1 cut(s) 200
MnlI CCTC 5 cut(s) 36, 71, 231, 238, 241
MseI TTAA 1 cut(s) 271
MspR9I CCNGG 1 cut(s) 162
MvaI CCWGG 1 cut(s) 162
NcoI CCATGG 1 cut(s) 253
NdeII GATC 1 cut(s) 135
NlaIII CATG 1 cut(s) 257
PleI GAGTC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 199
Psp6I CCWGG 1 cut(s) 160
PspGI CCWGG 1 cut(s) 160
PspPI GGNCC 1 cut(s) 250
RsaI GTAC 1 cut(s) 208
RsaNI GTAC 1 cut(s) 207
SaqAI TTAA 1 cut(s) 271
Sau3AI GATC 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 250
SchI GAGTC 1 cut(s) 200
ScrFI CCNGG 1 cut(s) 162
SetI ASST 6 cut(s) 36, 69, 82, 93, 166, 242
SinI GGWCC 1 cut(s) 250
Sse9I AATT 1 cut(s) 268
StyD4I CCNGG 1 cut(s) 160
StyI CCWWGG 1 cut(s) 253
TaaI ACNGT 1 cut(s) 157
TaqI TCGA 2 cut(s) 201, 218
TasI AATT 1 cut(s) 268
Tru1I TTAA 1 cut(s) 271
Tru9I TTAA 1 cut(s) 271
TscAI CASTG 1 cut(s) 118
TspRI CASTG 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 250
XcmI CCANNNNNNNNNTGG 1 cut(s) 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.