Rroxscaffold_7G00163290

Leucine-rich repeat receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
N/A
Physical Location & Seq
Forward (+)
5580783 .. 5583034
2252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00163290.1

Sequence Viewer

Length: 228 bp
ATGTTCAGGTCATTGGCATTGGGTCGTCCAGAAATAAACTACAACGTCTTGGGGATGGGGAGGAAAGAGCCATTGGTTAAGCCCATCTGGGGAGGAACATTTGGGTTGCCAGATTTGATGAAGGCCACGATGGAGATTTTGGGAAATGAAGGATTGGGGTTAGCTTACAAAGATGTGATGGGTACTGGGTTGTCCGTGGTGGTGAAGAGGGATGAGGGAGATGAATAG

Protein Analysis

75

Amino Acids

8.15

Weight (kDa)

5.37

Isoelectric Point (pI)

32.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 184
AfiI CCNNNNNNNGG 1 cut(s) 89
AjuI GAANNNNNNNTTGG 2 cut(s) 56, 88
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
AoxI GGCC 1 cut(s) 123
AsuHPI GGTGA 1 cut(s) 214
BccI CCATC 4 cut(s) 49, 92, 124, 172
BmrI ACTGGG 1 cut(s) 195
BmuI ACTGGG 1 cut(s) 195
BsaJI CCNNGG 1 cut(s) 195
Bsc4I CCNNNNNNNGG 1 cut(s) 89
Bse1I ACTGG 1 cut(s) 190
BseDI CCNNGG 1 cut(s) 195
BseGI GGATG 2 cut(s) 60, 217
BseLI CCNNNNNNNGG 1 cut(s) 89
BseNI ACTGG 1 cut(s) 190
BshFI GGCC 1 cut(s) 125
BslI CCNNNNNNNGG 1 cut(s) 89
BsnI GGCC 1 cut(s) 125
BspANI GGCC 1 cut(s) 125
BsrI ACTGG 1 cut(s) 190
BssECI CCNNGG 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 200
BstDSI CCRYGG 1 cut(s) 195
BstF5I GGATG 2 cut(s) 60, 217
BsuRI GGCC 1 cut(s) 125
BtgI CCRYGG 1 cut(s) 195
BtsCI GGATG 2 cut(s) 60, 217
Csp6I GTAC 1 cut(s) 183
CviJI RGCY 4 cut(s) 70, 82, 125, 164
CviKI_1 RGCY 4 cut(s) 70, 82, 125, 164
CviQI GTAC 1 cut(s) 183
Eam1104I CTCTTC 1 cut(s) 200
EarI CTCTTC 1 cut(s) 200
FokI GGATG 2 cut(s) 67, 224
HaeIII GGCC 1 cut(s) 125
HphI GGTGA 1 cut(s) 214
Hpy188III TCNNGA 1 cut(s) 29
HpyAV CCTTC 2 cut(s) 115, 143
HpyCH4IV ACGT 1 cut(s) 45
HpySE526I ACGT 1 cut(s) 45
LpnPI CCDG 4 cut(s) 42, 73, 123, 171
MaeII ACGT 1 cut(s) 45
MboII GAAGA 1 cut(s) 217
MnlI CCTC 4 cut(s) 54, 86, 201, 208
MseI TTAA 1 cut(s) 78
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
SaqAI TTAA 1 cut(s) 78
SetI ASST 3 cut(s) 11, 48, 166
SgeI CNNG 8 cut(s) 19, 41, 61, 100, 122, 139, 198, 208
TaiI ACGT 1 cut(s) 48
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TspDTI ATGAA 2 cut(s) 134, 162
TspGWI ACGGA 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.