Rorug01G0047500
NAC Family

(NAC) domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
N/A
Physical Location & Seq
Reverse (-)
7885438 .. 7885887
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0047500.1

Sequence Viewer

Length: 321 bp
ATGTACTTCAAATGCGGCGATGAGGTTGATCCACGCAAGGTGTTTGATAAAATGTTGTGGGAAATTTGTACTCGTGGAACAATATGCTATCTGGCTAGTGAGTTGTTTGATCGGATGCCTGAGAAGAACCCGGTGTCATGGACATCTATGATTTCGGGATATGCTAGGAATGGATTGGGGCATGAAGCGCTTGCATTGTTTGCAGAGATGATGCTGTTTCAAGTCAGGCCTGATCAGTTTACCTTTAGTAGTTGCCTTTGTGCTTGTGCTAGTATAGCTTCGCTTAAGCATGGTAAACAAATTCATGCCTCTTTAGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.99

Weight (kDa)

6.8

Isoelectric Point (pI)

38.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 43 - 90 5.7e-12 PPR repeat family
PPR PF01535 45 - 71 2.4e-09 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 15
AclWI GGATC 1 cut(s) 23
AcsI RAATTY 2 cut(s) 63, 300
AfaI GTAC 2 cut(s) 5, 70
AfeI AGCGCT 1 cut(s) 189
AflII CTTAAG 1 cut(s) 284
AgsI TTSAA 2 cut(s) 10, 221
AluBI AGCT 1 cut(s) 278
AluI AGCT 1 cut(s) 278
AlwI GGATC 1 cut(s) 23
Aor51HI AGCGCT 1 cut(s) 189
AoxI GGCC 1 cut(s) 227
ApoI RAATTY 2 cut(s) 63, 300
AspLEI GCGC 1 cut(s) 190
AsuC2I CCSGG 1 cut(s) 131
BauI CACGAG 1 cut(s) 72
BclI TGATCA 1 cut(s) 232
BcnI CCSGG 1 cut(s) 131
BfaI CTAG 3 cut(s) 96, 165, 270
BfoI RGCGCY 1 cut(s) 191
BfrI CTTAAG 1 cut(s) 284
BisI GCNGC 1 cut(s) 16
BlsI GCNGC 1 cut(s) 17
Bme1390I CCNGG 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 131
BmsI GCATC 2 cut(s) 105, 201
BpuMI CCSGG 1 cut(s) 131
BseGI GGATG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 111
BshFI GGCC 1 cut(s) 229
BsiSI CCGG 1 cut(s) 131
BsnI GGCC 1 cut(s) 229
Bsp143I GATC 3 cut(s) 28, 109, 232
BspACI CCGC 1 cut(s) 15
BspANI GGCC 1 cut(s) 229
BspCNI CTCAG 1 cut(s) 112
BspPI GGATC 1 cut(s) 23
BspTI CTTAAG 1 cut(s) 284
BssMI GATC 3 cut(s) 28, 109, 232
BssSI CACGAG 1 cut(s) 72
Bst2BI CACGAG 1 cut(s) 72
BstAFI CTTAAG 1 cut(s) 284
BstAPI GCANNNNNTGC 1 cut(s) 200
BstC8I GCNNGC 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 120
BstF5I GGATG 1 cut(s) 120
BstH2I RGCGCY 1 cut(s) 191
BstHHI GCGC 1 cut(s) 190
BstKTI GATC 3 cut(s) 31, 112, 235
BstMBI GATC 3 cut(s) 28, 109, 232
BstMWI GCNNNNNNNGC 3 cut(s) 187, 200, 275
BstSCI CCNGG 1 cut(s) 129
BsuRI GGCC 1 cut(s) 229
BtgZI GCGATG 1 cut(s) 33
BtsCI GGATG 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 192
CfoI GCGC 1 cut(s) 190
Csp6I GTAC 2 cut(s) 4, 69
CviAII CATG 4 cut(s) 138, 182, 290, 305
CviJI RGCY 3 cut(s) 95, 229, 278
CviKI_1 RGCY 3 cut(s) 95, 229, 278
CviQI GTAC 2 cut(s) 4, 69
DdeI CTNAG 1 cut(s) 120
DpnI GATC 3 cut(s) 30, 111, 234
DpnII GATC 3 cut(s) 28, 109, 232
Eco147I AGGCCT 1 cut(s) 229
Eco47III AGCGCT 1 cut(s) 189
FaeI CATG 4 cut(s) 141, 185, 293, 308
FaiI YATR 9 cut(s) 85, 139, 149, 162, 183, 275, 291, 306, 319
FatI CATG 4 cut(s) 137, 181, 289, 304
FbaI TGATCA 1 cut(s) 232
Fnu4HI GCNGC 1 cut(s) 16
FokI GGATG 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 16
FspBI CTAG 3 cut(s) 96, 165, 270
GlaI GCGC 1 cut(s) 189
GluI GCNGC 1 cut(s) 16
HaeII RGCGCY 1 cut(s) 191
HaeIII GGCC 1 cut(s) 229
HapII CCGG 1 cut(s) 131
HhaI GCGC 1 cut(s) 190
Hin1II CATG 4 cut(s) 141, 185, 293, 308
Hin6I GCGC 1 cut(s) 188
HinP1I GCGC 1 cut(s) 188
HpaII CCGG 1 cut(s) 131
Hpy166II GTNNAC 2 cut(s) 240, 296
Hpy188I TCNGA 1 cut(s) 114
Hpy188III TCNNGA 1 cut(s) 156
Hpy8I GTNNAC 2 cut(s) 240, 296
HpyCH4V TGCA 2 cut(s) 194, 203
HpyF10VI GCNNNNNNNGC 3 cut(s) 187, 200, 275
HpyF3I CTNAG 1 cut(s) 120
Hsp92II CATG 4 cut(s) 141, 185, 293, 308
HspAI GCGC 1 cut(s) 188
Ksp22I TGATCA 1 cut(s) 232
Kzo9I GATC 3 cut(s) 28, 109, 232
LpnPI CCDG 5 cut(s) 77, 132, 144, 211, 243
LweI GCATC 2 cut(s) 105, 201
MaeI CTAG 3 cut(s) 96, 165, 270
MalI GATC 3 cut(s) 30, 111, 234
MboI GATC 3 cut(s) 28, 109, 232
MboII GAAGA 1 cut(s) 136
MluCI AATT 2 cut(s) 63, 300
MnlI CCTC 2 cut(s) 16, 319
MseI TTAA 1 cut(s) 285
MspCI CTTAAG 1 cut(s) 284
MspI CCGG 1 cut(s) 131
MspR9I CCNGG 1 cut(s) 131
MwoI GCNNNNNNNGC 3 cut(s) 187, 200, 275
NciI CCSGG 1 cut(s) 131
NdeII GATC 3 cut(s) 28, 109, 232
NlaIII CATG 4 cut(s) 141, 185, 293, 308
PceI AGGCCT 1 cut(s) 229
PkrI GCNGC 1 cut(s) 17
RsaI GTAC 2 cut(s) 5, 70
RsaNI GTAC 2 cut(s) 4, 69
SaqAI TTAA 1 cut(s) 285
SatI GCNGC 1 cut(s) 16
Sau3AI GATC 3 cut(s) 28, 109, 232
ScrFI CCNGG 1 cut(s) 131
SetI ASST 4 cut(s) 27, 42, 245, 280
SfaNI GCATC 2 cut(s) 105, 201
SmlI CTYRAG 1 cut(s) 284
SmoI CTYRAG 1 cut(s) 284
Sse9I AATT 2 cut(s) 63, 300
SseBI AGGCCT 1 cut(s) 229
SsiI CCGC 1 cut(s) 15
SspMI CTAG 3 cut(s) 96, 165, 270
StuI AGGCCT 1 cut(s) 229
StyD4I CCNGG 1 cut(s) 129
TasI AATT 2 cut(s) 63, 300
TatI WGTACW 2 cut(s) 3, 68
TauI GCSGC 1 cut(s) 18
Tru1I TTAA 1 cut(s) 285
Tru9I TTAA 1 cut(s) 285
TspDTI ATGAA 2 cut(s) 198, 293
Vha464I CTTAAG 1 cut(s) 284
XapI RAATTY 2 cut(s) 63, 300
XspI CTAG 3 cut(s) 96, 165, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.