Rorug02G0470700

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
N/A
Physical Location & Seq
Reverse (-)
60170072 .. 60170290
219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0470700.1

Sequence Viewer

Length: 219 bp
ATGCTAAAGCGGGGTACATATCGAGGTATCTTTCCGCTATGTCACTGCTATGTTAAAGCAAATGGAGTAGCTATTTGTGCACTCTTTGCTAGTTGGTGCTTGTTAGAATACAAGTCTTCTGTAGAGATTTCTGATATTATTTCAGAAAATACTCTAGATGTTTATTGTAATCAGGGGTTTAGGCTCAATGTCCCCCCTTGTATTCGACAGTTTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.22

Weight (kDa)

8.27

Isoelectric Point (pI)

24.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 10, 35
AfaI GTAC 1 cut(s) 16
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw21I GWGCWC 1 cut(s) 82
Alw44I GTGCAC 1 cut(s) 78
ApaLI GTGCAC 1 cut(s) 78
BaeGI GKGCMC 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 108
Bbv12I GWGCWC 1 cut(s) 82
BfaI CTAG 2 cut(s) 90, 155
BfmI CTRYAG 1 cut(s) 120
BpiI GAAGAC 1 cut(s) 108
BseSI GKGCMC 1 cut(s) 82
BsiHKAI GWGCWC 1 cut(s) 82
BslFI GGGAC 1 cut(s) 176
BsmFI GGGAC 1 cut(s) 176
Bsp1286I GDGCHC 1 cut(s) 82
BspACI CCGC 2 cut(s) 10, 35
Bst4CI ACNGT 1 cut(s) 210
BstAPI GCANNNNNTGC 1 cut(s) 86
BstMWI GCNNNNNNNGC 2 cut(s) 77, 86
BstSFI CTRYAG 1 cut(s) 120
BstSLI GKGCMC 1 cut(s) 82
BstV2I GAAGAC 1 cut(s) 108
BtsI GCAGTG 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 43
Csp6I GTAC 1 cut(s) 15
CviJI RGCY 2 cut(s) 71, 184
CviKI_1 RGCY 2 cut(s) 71, 184
CviQI GTAC 1 cut(s) 15
FaiI YATR 3 cut(s) 19, 40, 51
FaqI GGGAC 1 cut(s) 176
FauI CCCGC 1 cut(s) 3
FspBI CTAG 2 cut(s) 90, 155
Hpy166II GTNNAC 1 cut(s) 80
Hpy188I TCNGA 2 cut(s) 133, 145
Hpy188III TCNNGA 1 cut(s) 155
Hpy8I GTNNAC 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 210
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 2 cut(s) 77, 86
LpnPI CCDG 1 cut(s) 158
MaeI CTAG 2 cut(s) 90, 155
MaeIII GTNAC 1 cut(s) 41
MboII GAAGA 1 cut(s) 108
MhlI GDGCHC 1 cut(s) 82
MnlI CCTC 1 cut(s) 17
MseI TTAA 2 cut(s) 54, 217
MslI CAYNNNNRTG 1 cut(s) 48
MwoI GCNNNNNNNGC 2 cut(s) 77, 86
NmuCI GTSAC 1 cut(s) 41
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
RseI CAYNNNNRTG 1 cut(s) 48
SaqAI TTAA 2 cut(s) 54, 217
SduI GDGCHC 1 cut(s) 82
SetI ASST 2 cut(s) 28, 73
SfcI CTRYAG 1 cut(s) 120
SgeI CNNG 8 cut(s) 23, 35, 102, 112, 124, 167, 185, 210
SmiMI CAYNNNNRTG 1 cut(s) 48
SsiI CCGC 2 cut(s) 10, 35
SspMI CTAG 2 cut(s) 90, 155
TaaI ACNGT 1 cut(s) 210
TaqI TCGA 2 cut(s) 22, 205
Tru1I TTAA 2 cut(s) 54, 217
Tru9I TTAA 2 cut(s) 54, 217
TscAI CASTG 1 cut(s) 50
TseFI GTSAC 1 cut(s) 41
Tsp45I GTSAC 1 cut(s) 41
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 1 cut(s) 50
VneI GTGCAC 1 cut(s) 78
XbaI TCTAGA 1 cut(s) 154
XspI CTAG 2 cut(s) 90, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.