Rh1AG165500

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
N/A
Physical Location & Seq
Forward (+)
31578660 .. 31579218
559 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG165500.1

Sequence Viewer

Length: 453 bp
ATGGAATCAACAGCTTCTTACATCTCGGCTCAGGAAGTAAAATATAGTTGCAATTACAGTTGTCGTTTGTCCACATATGGAGGTCCTCATGATGACTGTCAGCTCCTCGTGTGTAAACTCATGGATCATGATTATGTTGGATCTTTTCGACATTGGGTCTATATAGCAGGAGGGCTGTTTGCAGAAAGGTTGATCAAACGCTCTGTTCGAGCTGAAGTTAAAATCAACAGACCAGGGGTGAAAGTGAAAGCCTGTGGGGCAAGTCTAATATACTCTGGAGGTGTGACAGAATTTGTTTGGAATTTGAATCTCCGTGATGAAATTCATATGAGAAATCTGTCGAGTGGGGATCAAAAGGAAAATTCTGACGATCAGTTTAATAAACAAGAACAAGAAACTATTGATCATCTAGTAGAACCAGCAGCAGCACTGAAGAACCTCATCAAAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_3 LRR_8 NB-ARC TIR

Protein Analysis

150

Amino Acids

16.95

Weight (kDa)

6.2

Isoelectric Point (pI)

37.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 132, 148, 357
AcsI RAATTY 4 cut(s) 290, 301, 321, 361
AcuI CTGAAG 2 cut(s) 234, 452
AgsI TTSAA 1 cut(s) 307
AhdI GACNNNNNGTC 1 cut(s) 155
AjnI CCWGG 1 cut(s) 232
AluBI AGCT 3 cut(s) 14, 103, 212
AluI AGCT 3 cut(s) 14, 103, 212
AlwI GGATC 3 cut(s) 132, 148, 357
ApeKI GCWGC 2 cut(s) 422, 425
ApoI RAATTY 4 cut(s) 290, 301, 321, 361
AspS9I GGNCC 1 cut(s) 83
AsuHPI GGTGA 1 cut(s) 250
AvaII GGWCC 1 cut(s) 83
BauI CACGAG 1 cut(s) 107
BbvI GCAGC 2 cut(s) 434, 437
BciT130I CCWGG 1 cut(s) 234
BclI TGATCA 2 cut(s) 192, 403
BfaI CTAG 1 cut(s) 410
BglI GCCNNNNNGGC 1 cut(s) 257
BisI GCNGC 2 cut(s) 423, 426
BlsI GCNGC 2 cut(s) 424, 427
Bme1390I CCNGG 1 cut(s) 234
Bme18I GGWCC 1 cut(s) 83
BmeRI GACNNNNNGTC 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 83
BmrFI CCNGG 1 cut(s) 234
BpmI CTGGAG 1 cut(s) 297
Bpu10I CCTNAGC 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 233
BseBI CCWGG 1 cut(s) 234
BseDI CCNNGG 1 cut(s) 233
BseMII CTCAG 1 cut(s) 44
BseRI GAGGAG 1 cut(s) 95
BseXI GCAGC 2 cut(s) 434, 437
Bsp143I GATC 6 cut(s) 124, 140, 192, 349, 370, 403
BspCNI CTCAG 1 cut(s) 43
BspHI TCATGA 2 cut(s) 88, 127
BspPI GGATC 3 cut(s) 132, 148, 357
BssECI CCNNGG 1 cut(s) 233
BssMI GATC 6 cut(s) 124, 140, 192, 349, 370, 403
BssSI CACGAG 1 cut(s) 107
Bst2BI CACGAG 1 cut(s) 107
Bst2UI CCWGG 1 cut(s) 234
Bst4CI ACNGT 2 cut(s) 59, 98
BstDEI CTNAG 1 cut(s) 30
BstKTI GATC 6 cut(s) 127, 143, 195, 352, 373, 406
BstMBI GATC 6 cut(s) 124, 140, 192, 349, 370, 403
BstMWI GCNNNNNNNGC 1 cut(s) 257
BstNI CCWGG 1 cut(s) 234
BstSCI CCNGG 1 cut(s) 232
BstV1I GCAGC 2 cut(s) 434, 437
BstX2I RGATCY 1 cut(s) 140
BstYI RGATCY 1 cut(s) 140
BtsIMutI CAGTG 1 cut(s) 428
CciI TCATGA 2 cut(s) 88, 127
Cfr13I GGNCC 1 cut(s) 83
CviAII CATG 3 cut(s) 89, 121, 128
CviJI RGCY 6 cut(s) 14, 29, 103, 175, 212, 251
CviKI_1 RGCY 6 cut(s) 14, 29, 103, 175, 212, 251
DdeI CTNAG 1 cut(s) 30
DpnI GATC 6 cut(s) 126, 142, 194, 351, 372, 405
DpnII GATC 6 cut(s) 124, 140, 192, 349, 370, 403
DriI GACNNNNNGTC 1 cut(s) 155
Eam1105I GACNNNNNGTC 1 cut(s) 155
Eco47I GGWCC 1 cut(s) 83
Eco57I CTGAAG 2 cut(s) 234, 452
EcoO109I RGGNCCY 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 232
FaeI CATG 3 cut(s) 92, 124, 131
FatI CATG 3 cut(s) 88, 120, 127
FauNDI CATATG 2 cut(s) 76, 327
FbaI TGATCA 2 cut(s) 192, 403
Fnu4HI GCNGC 2 cut(s) 423, 426
Fsp4HI GCNGC 2 cut(s) 423, 426
FspBI CTAG 1 cut(s) 410
GluI GCNGC 2 cut(s) 423, 426
GsuI CTGGAG 1 cut(s) 297
Hin1II CATG 3 cut(s) 92, 124, 131
HinfI GANTC 2 cut(s) 5, 307
HphI GGTGA 1 cut(s) 250
Hpy166II GTNNAC 2 cut(s) 72, 116
Hpy188I TCNGA 1 cut(s) 367
Hpy188III TCNNGA 4 cut(s) 32, 89, 128, 276
Hpy8I GTNNAC 2 cut(s) 72, 116
HpyCH4III ACNGT 2 cut(s) 59, 98
HpyCH4V TGCA 2 cut(s) 51, 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 257
HpyF3I CTNAG 1 cut(s) 30
Hsp92II CATG 3 cut(s) 92, 124, 131
Ksp22I TGATCA 2 cut(s) 192, 403
Kzo9I GATC 6 cut(s) 124, 140, 192, 349, 370, 403
LmnI GCTCC 1 cut(s) 108
LpnPI CCDG 7 cut(s) 17, 153, 219, 246, 261, 265, 432
Lsp1109I GCAGC 2 cut(s) 434, 437
MaeI CTAG 1 cut(s) 410
MaeIII GTNAC 1 cut(s) 283
MalI GATC 6 cut(s) 126, 142, 194, 351, 372, 405
MboI GATC 6 cut(s) 124, 140, 192, 349, 370, 403
MboII GAAGA 1 cut(s) 445
MflI RGATCY 1 cut(s) 140
MluCI AATT 5 cut(s) 52, 290, 301, 321, 361
MmeI TCCRAC 1 cut(s) 118
MnlI CCTC 6 cut(s) 74, 96, 116, 164, 272, 449
MseI TTAA 2 cut(s) 219, 378
MslI CAYNNNNRTG 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 234
MvaI CCWGG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 257
NdeI CATATG 2 cut(s) 76, 327
NdeII GATC 6 cut(s) 124, 140, 192, 349, 370, 403
NlaIII CATG 3 cut(s) 92, 124, 131
NmeAIII GCCGAG 1 cut(s) 5
NmuCI GTSAC 1 cut(s) 283
PagI TCATGA 2 cut(s) 88, 127
PcsI WCGNNNNNNNCGW 1 cut(s) 205
PfeI GAWTC 2 cut(s) 5, 307
PkrI GCNGC 2 cut(s) 424, 427
PpuMI RGGWCCY 1 cut(s) 83
Psp5II RGGWCCY 1 cut(s) 83
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
PspPI GGNCC 1 cut(s) 83
PspPPI RGGWCCY 1 cut(s) 83
PsuI RGATCY 1 cut(s) 140
RseI CAYNNNNRTG 1 cut(s) 132
SaqAI TTAA 2 cut(s) 219, 378
SatI GCNGC 2 cut(s) 423, 426
Sau3AI GATC 6 cut(s) 124, 140, 192, 349, 370, 403
Sau96I GGNCC 1 cut(s) 83
ScrFI CCNGG 1 cut(s) 234
SetI ASST 7 cut(s) 16, 85, 105, 191, 214, 283, 441
SinI GGWCC 1 cut(s) 83
SmiMI CAYNNNNRTG 1 cut(s) 132
Sse9I AATT 5 cut(s) 52, 290, 301, 321, 361
SspMI CTAG 1 cut(s) 410
StyD4I CCNGG 1 cut(s) 232
TaaI ACNGT 2 cut(s) 59, 98
TaqI TCGA 3 cut(s) 148, 208, 341
TasI AATT 5 cut(s) 52, 290, 301, 321, 361
TfiI GAWTC 2 cut(s) 5, 307
Tru1I TTAA 2 cut(s) 219, 378
Tru9I TTAA 2 cut(s) 219, 378
TscAI CASTG 1 cut(s) 435
TseFI GTSAC 1 cut(s) 283
TseI GCWGC 2 cut(s) 422, 425
Tsp45I GTSAC 1 cut(s) 283
TspDTI ATGAA 2 cut(s) 314, 333
TspGWI ACGGA 1 cut(s) 302
TspRI CASTG 1 cut(s) 435
VpaK11BI GGWCC 1 cut(s) 83
XapI RAATTY 4 cut(s) 290, 301, 321, 361
XspI CTAG 1 cut(s) 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.