Rh1CG063800

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
N/A
Physical Location & Seq
Forward (+)
12642416 .. 12644333
1918 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG063800.1

Sequence Viewer

Length: 195 bp
ATGGTGAAGGTATGGGCTGAGAAAGAAAAGAGGAATCTGGACAGGGAATTGAAGTCTGGTTGCTCTTTCACCAAAAGCAAGGCTATCAAAGACATCAGCCAGTCGCTAGATATATCACCTCTATATAAGACAGCAAAAGGTTTTAGTAAACTATTCTACTACCAGTTCAACATCAATGAAGATGCTACTTATCTG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.59

Weight (kDa)

9.3

Isoelectric Point (pI)

38.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 52, 169
AsuHPI GGTGA 3 cut(s) 16, 61, 108
BfaI CTAG 1 cut(s) 107
BmsI GCATC 1 cut(s) 172
Bse1I ACTGG 2 cut(s) 100, 163
BseMII CTCAG 1 cut(s) 9
BseNI ACTGG 2 cut(s) 100, 163
BspCNI CTCAG 1 cut(s) 10
BsrI ACTGG 2 cut(s) 100, 163
BstDEI CTNAG 1 cut(s) 18
CviJI RGCY 3 cut(s) 17, 83, 99
CviKI_1 RGCY 3 cut(s) 17, 83, 99
DdeI CTNAG 1 cut(s) 18
FaiI YATR 4 cut(s) 13, 113, 124, 126
FspBI CTAG 1 cut(s) 107
HinfI GANTC 1 cut(s) 34
HphI GGTGA 3 cut(s) 16, 61, 108
Hpy166II GTNNAC 1 cut(s) 149
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 149
HpyF3I CTNAG 1 cut(s) 18
LpnPI CCDG 5 cut(s) 23, 28, 42, 113, 176
LweI GCATC 1 cut(s) 172
MaeI CTAG 1 cut(s) 107
MboII GAAGA 1 cut(s) 191
MluCI AATT 1 cut(s) 47
MnlI CCTC 2 cut(s) 24, 129
PfeI GAWTC 1 cut(s) 34
SetI ASST 3 cut(s) 12, 121, 142
SfaNI GCATC 1 cut(s) 172
SgeI CNNG 7 cut(s) 50, 55, 69, 91, 112, 119, 175
Sse9I AATT 1 cut(s) 47
SspMI CTAG 1 cut(s) 107
TasI AATT 1 cut(s) 47
TfiI GAWTC 1 cut(s) 34
TspDTI ATGAA 1 cut(s) 192
XspI CTAG 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.