Rh1DG145100

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
N/A
Physical Location & Seq
Forward (+)
30533609 .. 30546259
12651 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG145100.1

Sequence Viewer

Length: 216 bp
ATGGTAGAGCACTCGAGCCAAATTTACTTTCCATTATGGGTGTATGATCAATATAGTCATGGAAATGATCATTTAGAGATGGTTGACGTCACAGAGGAGGAAAGAGCGATAATTAAGAAGATGAAGAAGTCAAGCTATGGAGCACAAAGGAGGTGCATCAATCCCCGCAGATTTCTTGCCTCCGATAGTGATCAGAGGAATCCTATTTCTGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.37

Weight (kDa)

6.82

Isoelectric Point (pI)

48.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 90
AciI CCGC 1 cut(s) 166
AcsI RAATTY 1 cut(s) 21
AcyI GRCGYC 1 cut(s) 87
AjuI GAANNNNNNNTTGG 2 cut(s) 12, 44
AluBI AGCT 1 cut(s) 135
AluI AGCT 1 cut(s) 135
Alw21I GWGCWC 2 cut(s) 12, 145
Ama87I CYCGRG 1 cut(s) 13
ApoI RAATTY 1 cut(s) 21
AvaI CYCGRG 1 cut(s) 13
Bbv12I GWGCWC 2 cut(s) 12, 145
BccI CCATC 1 cut(s) 73
BclI TGATCA 3 cut(s) 46, 67, 190
BmeT110I CYCGRG 1 cut(s) 13
BmsI GCATC 1 cut(s) 165
BsaBI GATNNNNATC 1 cut(s) 189
BsaHI GRCGYC 1 cut(s) 87
Bse8I GATNNNNATC 1 cut(s) 189
BseJI GATNNNNATC 1 cut(s) 189
BseRI GAGGAG 1 cut(s) 110
BsiHKAI GWGCWC 2 cut(s) 12, 145
BsiHKCI CYCGRG 1 cut(s) 13
BsoBI CYCGRG 1 cut(s) 13
Bsp1286I GDGCHC 2 cut(s) 12, 145
Bsp143I GATC 3 cut(s) 46, 67, 190
BspACI CCGC 1 cut(s) 166
BssMI GATC 3 cut(s) 46, 67, 190
BssNI GRCGYC 1 cut(s) 87
BstACI GRCGYC 1 cut(s) 87
BstKTI GATC 3 cut(s) 49, 70, 193
BstMBI GATC 3 cut(s) 46, 67, 190
CviAII CATG 1 cut(s) 59
CviJI RGCY 2 cut(s) 18, 135
CviKI_1 RGCY 2 cut(s) 18, 135
DpnI GATC 3 cut(s) 48, 69, 192
DpnII GATC 3 cut(s) 46, 67, 190
Eco88I CYCGRG 1 cut(s) 13
FaeI CATG 1 cut(s) 62
FaiI YATR 5 cut(s) 37, 45, 54, 60, 138
FatI CATG 1 cut(s) 58
FauI CCCGC 1 cut(s) 173
FbaI TGATCA 3 cut(s) 46, 67, 190
Hin1I GRCGYC 1 cut(s) 87
Hin1II CATG 1 cut(s) 62
HincII GTYRAC 1 cut(s) 85
HindII GTYRAC 1 cut(s) 85
HinfI GANTC 1 cut(s) 199
Hpy166II GTNNAC 1 cut(s) 85
Hpy188I TCNGA 2 cut(s) 184, 195
Hpy8I GTNNAC 1 cut(s) 85
HpyCH4IV ACGT 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 156
HpySE526I ACGT 1 cut(s) 87
Hsp92I GRCGYC 1 cut(s) 87
Hsp92II CATG 1 cut(s) 62
Ksp22I TGATCA 3 cut(s) 46, 67, 190
Kzo9I GATC 3 cut(s) 46, 67, 190
LmnI GCTCC 1 cut(s) 140
LweI GCATC 1 cut(s) 165
MaeII ACGT 1 cut(s) 87
MaeIII GTNAC 1 cut(s) 88
MalI GATC 3 cut(s) 48, 69, 192
MboI GATC 3 cut(s) 46, 67, 190
MboII GAAGA 2 cut(s) 130, 136
MhlI GDGCHC 2 cut(s) 12, 145
MluCI AATT 2 cut(s) 21, 111
MnlI CCTC 5 cut(s) 88, 91, 144, 189, 190
MseI TTAA 1 cut(s) 114
MslI CAYNNNNRTG 1 cut(s) 63
NdeII GATC 3 cut(s) 46, 67, 190
NlaIII CATG 1 cut(s) 62
NmuCI GTSAC 1 cut(s) 88
PaeR7I CTCGAG 1 cut(s) 13
PfeI GAWTC 1 cut(s) 199
PspXI VCTCGAGB 1 cut(s) 13
RseI CAYNNNNRTG 1 cut(s) 63
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 3 cut(s) 46, 67, 190
SduI GDGCHC 2 cut(s) 12, 145
SetI ASST 3 cut(s) 90, 137, 155
SfaNI GCATC 1 cut(s) 165
Sfr274I CTCGAG 1 cut(s) 13
SgeI CNNG 6 cut(s) 25, 27, 71, 144, 177, 188
SlaI CTCGAG 1 cut(s) 13
SmiMI CAYNNNNRTG 1 cut(s) 63
SmlI CTYRAG 1 cut(s) 13
SmoI CTYRAG 1 cut(s) 13
Sse9I AATT 2 cut(s) 21, 111
SsiI CCGC 1 cut(s) 166
TaiI ACGT 1 cut(s) 90
TaqI TCGA 1 cut(s) 14
TasI AATT 2 cut(s) 21, 111
TfiI GAWTC 1 cut(s) 199
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 1 cut(s) 137
XapI RAATTY 1 cut(s) 21
XhoI CTCGAG 1 cut(s) 13
ZraI GACGTC 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.