Rh2AG418800

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
N/A
Physical Location & Seq
Reverse (-)
62211074 .. 62216408
5335 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG418800.1

Sequence Viewer

Length: 207 bp
ATGAGAGTTCATCACACGAACTTGACAAGCCTTGTTGGATATTGCAATGATGAAAACAATATGGGGCTCGTCTATGAGTACATGGCCAATGGAAACTTACAAGAACATCTTTCAGTAACCAAAATCTTTCCTCCAATGATGATATTTGATATCTCAAATGCTGTCTCGCTCCTTTTGGGTAGTCTTGGGAAGGTGGATTATGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

68

Amino Acids

7.59

Weight (kDa)

5.3

Isoelectric Point (pI)

14.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 2 - 40 5.9e-06 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 84
AfaI GTAC 1 cut(s) 80
Alw26I GTCTC 1 cut(s) 169
AoxI GGCC 1 cut(s) 84
BalI TGGCCA 1 cut(s) 86
BanII GRGCYC 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 169
Bse3DI GCAATG 1 cut(s) 52
BseMI GCAATG 1 cut(s) 52
BshFI GGCC 1 cut(s) 86
BsmAI GTCTC 1 cut(s) 169
BsnI GGCC 1 cut(s) 86
Bsp1286I GDGCHC 1 cut(s) 69
BspANI GGCC 1 cut(s) 86
BsrDI GCAATG 1 cut(s) 52
BstMAI GTCTC 1 cut(s) 169
BsuRI GGCC 1 cut(s) 86
Csp6I GTAC 1 cut(s) 79
CviAII CATG 1 cut(s) 82
CviJI RGCY 3 cut(s) 30, 67, 86
CviKI_1 RGCY 3 cut(s) 30, 67, 86
CviQI GTAC 1 cut(s) 79
EaeI YGGCCR 1 cut(s) 84
Eco24I GRGCYC 1 cut(s) 69
Eco32I GATATC 1 cut(s) 151
EcoRV GATATC 1 cut(s) 151
EcoT22I ATGCAT 1 cut(s) 205
EcoT38I GRGCYC 1 cut(s) 69
FaeI CATG 1 cut(s) 85
FaiI YATR 5 cut(s) 62, 75, 83, 201, 205
FalI AAGNNNNNCTT 2 cut(s) 93, 125
FatI CATG 1 cut(s) 81
FriOI GRGCYC 1 cut(s) 69
HaeIII GGCC 1 cut(s) 86
Hin1II CATG 1 cut(s) 85
HpyAV CCTTC 1 cut(s) 184
HpyCH4V TGCA 2 cut(s) 45, 203
Hsp92II CATG 1 cut(s) 85
LmnI GCTCC 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 115
MhlI GDGCHC 1 cut(s) 69
MlsI TGGCCA 1 cut(s) 86
MluNI TGGCCA 1 cut(s) 86
MmeI TCCRAC 1 cut(s) 16
MnlI CCTC 1 cut(s) 141
Mox20I TGGCCA 1 cut(s) 86
Mph1103I ATGCAT 1 cut(s) 205
MscI TGGCCA 1 cut(s) 86
Msp20I TGGCCA 1 cut(s) 86
NlaIII CATG 1 cut(s) 85
NsiI ATGCAT 1 cut(s) 205
RsaI GTAC 1 cut(s) 80
RsaNI GTAC 1 cut(s) 79
SduI GDGCHC 1 cut(s) 69
SetI ASST 1 cut(s) 195
SgeI CNNG 9 cut(s) 28, 34, 39, 44, 80, 94, 113, 178, 197
TatI WGTACW 1 cut(s) 78
TspDTI ATGAA 1 cut(s) 66
Zsp2I ATGCAT 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.