Rh2BG206900

Exostosin family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
N/A
Physical Location & Seq
Forward (+)
19109992 .. 19118480
8489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG206900.1

Sequence Viewer

Length: 255 bp
ATGAGTGAAAGTGGAAACGGCAAGCTCAGTGGAGAAGGAGGAGGTTGCGTCCTTAAAGCTGAAAGTGGAAATGGCAAGCTCAGTGGAGAAGAAGCATACCTATTTTTTGTGTTGACGTATACAAAATGTGTTCGAATGTTGGGTGGTCTTAATGATAAAGAGATTAACCAAACATATGTATATGTGAAGGTCTCAAGTGAGGAATCTGCAGATAGCAGAAAGAATAAGACAAAAGGCAGGTATGCCAAATCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.05

Weight (kDa)

8.91

Isoelectric Point (pI)

31.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 228
AccI GTMKAC 1 cut(s) 119
AluBI AGCT 3 cut(s) 25, 59, 79
AluI AGCT 3 cut(s) 25, 59, 79
Alw26I GTCTC 1 cut(s) 196
AsuII TTCGAA 1 cut(s) 133
BceAI ACGGC 1 cut(s) 34
BcoDI GTCTC 1 cut(s) 196
BfmI CTRYAG 1 cut(s) 207
BfuAI ACCTGC 1 cut(s) 228
Bpu14I TTCGAA 1 cut(s) 133
BpuEI CTTGAG 1 cut(s) 178
BsaI GGTCTC 1 cut(s) 196
BsaXI ACNNNNNCTCC 2 cut(s) 33, 63
BseMII CTCAG 2 cut(s) 40, 94
BseRI GAGGAG 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 196
Bso31I GGTCTC 1 cut(s) 196
Bsp119I TTCGAA 1 cut(s) 133
BspCNI CTCAG 2 cut(s) 39, 93
BspMAI CTGCAG 1 cut(s) 211
BspMI ACCTGC 1 cut(s) 228
BspT104I TTCGAA 1 cut(s) 133
BspTNI GGTCTC 1 cut(s) 196
BssNAI GTATAC 1 cut(s) 120
Bst1107I GTATAC 1 cut(s) 120
BstBI TTCGAA 1 cut(s) 133
BstC8I GCNNGC 2 cut(s) 23, 77
BstDEI CTNAG 2 cut(s) 26, 80
BstMAI GTCTC 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 207
BstZ17I GTATAC 1 cut(s) 120
BtsIMutI CAGTG 2 cut(s) 34, 88
BveI ACCTGC 1 cut(s) 228
Cac8I GCNNGC 2 cut(s) 23, 77
CseI GACGC 1 cut(s) 37
CspCI CAANNNNNGTGG 4 cut(s) 10, 45, 64, 99
CviJI RGCY 3 cut(s) 25, 59, 79
CviKI_1 RGCY 3 cut(s) 25, 59, 79
DdeI CTNAG 2 cut(s) 26, 80
Eco31I GGTCTC 1 cut(s) 196
FaiI YATR 8 cut(s) 97, 120, 175, 177, 181, 183, 243, 253
FauNDI CATATG 1 cut(s) 175
FblI GTMKAC 1 cut(s) 119
HgaI GACGC 1 cut(s) 37
HincII GTYRAC 1 cut(s) 114
HindII GTYRAC 1 cut(s) 114
HinfI GANTC 1 cut(s) 203
Hpy166II GTNNAC 2 cut(s) 114, 120
Hpy8I GTNNAC 2 cut(s) 114, 120
HpyAV CCTTC 2 cut(s) 29, 181
HpyCH4IV ACGT 1 cut(s) 116
HpyCH4V TGCA 1 cut(s) 209
HpyF3I CTNAG 2 cut(s) 26, 80
HpySE526I ACGT 1 cut(s) 116
LpnPI CCDG 1 cut(s) 223
MaeII ACGT 1 cut(s) 116
MboII GAAGA 1 cut(s) 101
MnlI CCTC 3 cut(s) 32, 35, 193
MseI TTAA 3 cut(s) 54, 150, 165
NdeI CATATG 1 cut(s) 175
NspV TTCGAA 1 cut(s) 133
PfeI GAWTC 1 cut(s) 203
PstI CTGCAG 1 cut(s) 211
SaqAI TTAA 3 cut(s) 54, 150, 165
SetI ASST 8 cut(s) 27, 46, 61, 81, 102, 119, 192, 242
SfcI CTRYAG 1 cut(s) 207
SfuI TTCGAA 1 cut(s) 133
SgeI CNNG 4 cut(s) 34, 88, 207, 250
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
TaiI ACGT 1 cut(s) 119
TaqI TCGA 1 cut(s) 133
TfiI GAWTC 1 cut(s) 203
Tru1I TTAA 3 cut(s) 54, 150, 165
Tru9I TTAA 3 cut(s) 54, 150, 165
TscAI CASTG 2 cut(s) 34, 88
TspRI CASTG 2 cut(s) 34, 88
XmiI GTMKAC 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.