Rh2BG366200

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
N/A
Physical Location & Seq
Forward (+)
50924370 .. 50958242
33873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG366200.1

Sequence Viewer

Length: 348 bp
ATGGGAGATCAATTACAAGGTCCAATCCCAGATGTTTTCGCAAAAATGGTTTCTCTAGTATCTCTTGATCTCTCTTATAACCATCTAGAAGGTGGGATCCCAAAATCCTTTCAAAACATTTGCAGCTTAGAATCATTGAATTTATGGGAAAATAAATTGTCTGACAGACTTGAAAACTCTGTCAAAAACTTGGCTTGTTCTGAAAGTACCCTTAAGTCATTGTTCTTAAGTGGGAATCCATTTTGGGGGTCCTTTCCTGCTGAACTTACACAATTTGTATCCTTGACAGAATTATACATTGATGGTACCAATATGAGTGGATTGCTCCCGAAAGATAACATTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.7

Weight (kDa)

4.49

Isoelectric Point (pI)

43.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_8 PF13855 10 - 53 1.3e-06 Leucine rich repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 78
Acc65I GGTACC 1 cut(s) 305
AccB1I GGYRCC 1 cut(s) 305
AclWI GGATC 2 cut(s) 91, 104
AcsI RAATTY 1 cut(s) 139
AfaI GTAC 2 cut(s) 208, 307
AfiI CCNNNNNNNGG 1 cut(s) 245
AflII CTTAAG 2 cut(s) 212, 226
AgsI TTSAA 4 cut(s) 113, 139, 173, 344
AluBI AGCT 1 cut(s) 126
AluI AGCT 1 cut(s) 126
AlwI GGATC 2 cut(s) 91, 104
ApeKI GCWGC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 139
Asp718I GGTACC 1 cut(s) 305
AspS9I GGNCC 2 cut(s) 20, 249
AvaII GGWCC 2 cut(s) 20, 249
BamHI GGATCC 1 cut(s) 96
BanI GGYRCC 1 cut(s) 305
BbvI GCAGC 1 cut(s) 135
BccI CCATC 2 cut(s) 90, 296
BciVI GTATCC 1 cut(s) 289
BfaI CTAG 2 cut(s) 56, 86
BfrI CTTAAG 2 cut(s) 212, 226
BfuI GTATCC 1 cut(s) 289
BisI GCNGC 1 cut(s) 124
BlsI GCNGC 1 cut(s) 125
Bme18I GGWCC 2 cut(s) 20, 249
BmgT120I GGNCC 2 cut(s) 20, 249
BmiI GGNNCC 3 cut(s) 98, 250, 307
Bsc4I CCNNNNNNNGG 1 cut(s) 245
BseLI CCNNNNNNNGG 1 cut(s) 245
BseXI GCAGC 1 cut(s) 135
BshNI GGYRCC 1 cut(s) 305
BslI CCNNNNNNNGG 1 cut(s) 245
Bsp143I GATC 3 cut(s) 7, 67, 96
BspLI GGNNCC 3 cut(s) 98, 250, 307
BspPI GGATC 2 cut(s) 91, 104
BspT107I GGYRCC 1 cut(s) 305
BspTI CTTAAG 2 cut(s) 212, 226
BssMI GATC 3 cut(s) 7, 67, 96
BstAFI CTTAAG 2 cut(s) 212, 226
BstDEI CTNAG 1 cut(s) 127
BstKTI GATC 3 cut(s) 10, 70, 99
BstMBI GATC 3 cut(s) 7, 67, 96
BstV1I GCAGC 1 cut(s) 135
BstX2I RGATCY 1 cut(s) 96
BstYI RGATCY 1 cut(s) 96
BsuI GTATCC 1 cut(s) 289
Cfr13I GGNCC 2 cut(s) 20, 249
Csp6I GTAC 2 cut(s) 207, 306
CspCI CAANNNNNGTGG 2 cut(s) 298, 333
CviJI RGCY 2 cut(s) 126, 194
CviKI_1 RGCY 2 cut(s) 126, 194
CviQI GTAC 2 cut(s) 207, 306
DdeI CTNAG 1 cut(s) 127
DpnI GATC 3 cut(s) 9, 69, 98
DpnII GATC 3 cut(s) 7, 67, 96
Eco47I GGWCC 2 cut(s) 20, 249
EcoO109I RGGNCCY 1 cut(s) 249
FaiI YATR 4 cut(s) 78, 145, 295, 314
Fnu4HI GCNGC 1 cut(s) 124
Fsp4HI GCNGC 1 cut(s) 124
FspBI CTAG 2 cut(s) 56, 86
GluI GCNGC 1 cut(s) 124
HinfI GANTC 2 cut(s) 131, 235
Hpy188I TCNGA 2 cut(s) 163, 202
Hpy188III TCNNGA 3 cut(s) 65, 86, 328
HpyAV CCTTC 1 cut(s) 83
HpyCH4V TGCA 1 cut(s) 123
HpyF3I CTNAG 1 cut(s) 127
KpnI GGTACC 1 cut(s) 309
Kzo9I GATC 3 cut(s) 7, 67, 96
LmnI GCTCC 1 cut(s) 330
LpnPI CCDG 2 cut(s) 42, 270
Lsp1109I GCAGC 1 cut(s) 135
MaeI CTAG 2 cut(s) 56, 86
MalI GATC 3 cut(s) 9, 69, 98
MboI GATC 3 cut(s) 7, 67, 96
MflI RGATCY 1 cut(s) 96
MluCI AATT 5 cut(s) 11, 139, 155, 272, 290
MseI TTAA 2 cut(s) 213, 227
MspCI CTTAAG 2 cut(s) 212, 226
NdeII GATC 3 cut(s) 7, 67, 96
NlaIV GGNNCC 3 cut(s) 98, 250, 307
PfeI GAWTC 2 cut(s) 131, 235
PkrI GCNGC 1 cut(s) 125
PpuMI RGGWCCY 1 cut(s) 249
PsiI TTATAA 1 cut(s) 78
Psp5II RGGWCCY 1 cut(s) 249
PspN4I GGNNCC 3 cut(s) 98, 250, 307
PspPI GGNCC 2 cut(s) 20, 249
PspPPI RGGWCCY 1 cut(s) 249
PsuI RGATCY 1 cut(s) 96
RsaI GTAC 2 cut(s) 208, 307
RsaNI GTAC 2 cut(s) 207, 306
SaqAI TTAA 2 cut(s) 213, 227
SatI GCNGC 1 cut(s) 124
Sau3AI GATC 3 cut(s) 7, 67, 96
Sau96I GGNCC 2 cut(s) 20, 249
SetI ASST 3 cut(s) 22, 94, 128
SinI GGWCC 2 cut(s) 20, 249
SmlI CTYRAG 2 cut(s) 212, 226
SmoI CTYRAG 2 cut(s) 212, 226
Sse9I AATT 5 cut(s) 11, 139, 155, 272, 290
SspMI CTAG 2 cut(s) 56, 86
TasI AATT 5 cut(s) 11, 139, 155, 272, 290
TfiI GAWTC 2 cut(s) 131, 235
Tru1I TTAA 2 cut(s) 213, 227
Tru9I TTAA 2 cut(s) 213, 227
TseI GCWGC 1 cut(s) 123
Vha464I CTTAAG 2 cut(s) 212, 226
VpaK11BI GGWCC 2 cut(s) 20, 249
XapI RAATTY 1 cut(s) 139
XbaI TCTAGA 1 cut(s) 85
XcmI CCANNNNNNNNNTGG 1 cut(s) 89
XspI CTAG 2 cut(s) 56, 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.