Rh2BG543100

Serine threonine-protein kinase WNK8-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
N/A
Physical Location & Seq
Reverse (-)
75144494 .. 75156776
12283 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG543100.1

Sequence Viewer

Length: 216 bp
ATGAATTCTGATAATAGTAAAACTATTGCTTTAACCTTGAGTGTTGCTGATCCACCCAGTCGTCGTGAGAAGAAGACTAGTGAGTTCGATTTCTATATTAATTTGGATGCTACAATTTCAAGTGGAAACCTGCTACATCGTGTACCAGAACATGAAAAAGTAAATATAATGCAGTCGTACATTGCTAGTGAAGGTTCAATTAATATGACAATCTAA

Protein Analysis

71

Amino Acids

7.93

Weight (kDa)

5.51

Isoelectric Point (pI)

50.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 138
AclWI GGATC 1 cut(s) 44
AcsI RAATTY 1 cut(s) 4
AfaI GTAC 2 cut(s) 144, 179
AgsI TTSAA 2 cut(s) 120, 198
AhlI ACTAGT 1 cut(s) 77
AlwI GGATC 1 cut(s) 44
ApoI RAATTY 1 cut(s) 4
AseI ATTAAT 2 cut(s) 99, 201
BbsI GAAGAC 1 cut(s) 80
BcuI ACTAGT 1 cut(s) 77
BfaI CTAG 2 cut(s) 78, 186
BfuAI ACCTGC 1 cut(s) 138
BmrI ACTGGG 1 cut(s) 51
BmsI GCATC 1 cut(s) 97
BmuI ACTGGG 1 cut(s) 51
BpiI GAAGAC 1 cut(s) 80
BpuEI CTTGAG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 57
Bse3DI GCAATG 1 cut(s) 180
BseGI GGATG 1 cut(s) 112
BseMI GCAATG 1 cut(s) 180
BseNI ACTGG 1 cut(s) 57
Bsp143I GATC 1 cut(s) 49
BspMI ACCTGC 1 cut(s) 138
BspPI GGATC 1 cut(s) 44
BsrDI GCAATG 1 cut(s) 180
BsrI ACTGG 1 cut(s) 57
BssMI GATC 1 cut(s) 49
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BstV2I GAAGAC 1 cut(s) 80
BtsCI GGATG 1 cut(s) 112
BveI ACCTGC 1 cut(s) 138
Csp6I GTAC 2 cut(s) 143, 178
CviAII CATG 1 cut(s) 152
CviQI GTAC 2 cut(s) 143, 178
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
EcoRI GAATTC 1 cut(s) 4
FaeI CATG 1 cut(s) 155
FaiI YATR 4 cut(s) 96, 153, 167, 206
FatI CATG 1 cut(s) 151
FokI GGATG 1 cut(s) 119
FspBI CTAG 2 cut(s) 78, 186
FspEI CC 9 cut(s) 49, 66, 69, 70, 89, 108, 143, 159, 177
Hin1II CATG 1 cut(s) 155
Hpy166II GTNNAC 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 143
Hpy99I CGWCG 1 cut(s) 66
HpyAV CCTTC 1 cut(s) 185
HpyCH4V TGCA 1 cut(s) 172
Hsp92II CATG 1 cut(s) 155
Kzo9I GATC 1 cut(s) 49
LpnPI CCDG 3 cut(s) 70, 143, 159
LweI GCATC 1 cut(s) 97
MaeI CTAG 2 cut(s) 78, 186
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MboII GAAGA 2 cut(s) 82, 85
MluCI AATT 4 cut(s) 4, 100, 114, 198
MseI TTAA 3 cut(s) 32, 99, 201
NdeII GATC 1 cut(s) 49
NlaIII CATG 1 cut(s) 155
PshBI ATTAAT 2 cut(s) 99, 201
RsaI GTAC 2 cut(s) 144, 179
RsaNI GTAC 2 cut(s) 143, 178
SaqAI TTAA 3 cut(s) 32, 99, 201
Sau3AI GATC 1 cut(s) 49
SetI ASST 3 cut(s) 38, 132, 196
SfaNI GCATC 1 cut(s) 97
SmlI CTYRAG 1 cut(s) 37
SmoI CTYRAG 1 cut(s) 37
SpeI ACTAGT 1 cut(s) 77
Sse9I AATT 4 cut(s) 4, 100, 114, 198
SspMI CTAG 2 cut(s) 78, 186
TaqI TCGA 1 cut(s) 87
TasI AATT 4 cut(s) 4, 100, 114, 198
Tru1I TTAA 3 cut(s) 32, 99, 201
Tru9I TTAA 3 cut(s) 32, 99, 201
TspDTI ATGAA 2 cut(s) 17, 168
VspI ATTAAT 2 cut(s) 99, 201
XapI RAATTY 1 cut(s) 4
XspI CTAG 2 cut(s) 78, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.