Rh2CG408200

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
N/A
Physical Location & Seq
Forward (+)
55486319 .. 55489465
3147 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG408200.1

Sequence Viewer

Length: 237 bp
ATGAGTCAGGTAGTGACAGAGCTGAAGGACTGCTTGGCTGCAGAATTGGCTCGAAAGGAGAGCTATGCAACAGAATCGAAAGATTCAGTTGAGATGATGTCACTGAAATTCACCACTGAGATGAGACCCCTGCCTAGCATGACATTCAATCCCTTCACTGAACATGACACATGGATAGTGGAAATAGTAAAAGATAGTAGTGGAAATAGAATTTTCCCAAAAGGAGGTCTTGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

78

Amino Acids

8.76

Weight (kDa)

5.02

Isoelectric Point (pI)

53.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 107, 210
AcuI CTGAAG 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 224
AgsI TTSAA 1 cut(s) 148
AjuI GAANNNNNNNTTGG 2 cut(s) 17, 49
AluBI AGCT 2 cut(s) 22, 63
AluI AGCT 2 cut(s) 22, 63
Alw26I GTCTC 1 cut(s) 118
ApeKI GCWGC 1 cut(s) 38
ApoI RAATTY 2 cut(s) 107, 210
AsuHPI GGTGA 1 cut(s) 103
BbvI GCAGC 1 cut(s) 25
BcgI CGANNNNNNTGC 2 cut(s) 57, 91
BcoDI GTCTC 1 cut(s) 118
BfaI CTAG 1 cut(s) 135
BfmI CTRYAG 1 cut(s) 39
BisI GCNGC 1 cut(s) 39
BlsI GCNGC 1 cut(s) 40
BsaI GGTCTC 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 224
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMII CTCAG 1 cut(s) 108
BseXI GCAGC 1 cut(s) 25
BslI CCNNNNNNNGG 1 cut(s) 224
BsmAI GTCTC 1 cut(s) 118
Bso31I GGTCTC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 109
BspMAI CTGCAG 1 cut(s) 43
BspTNI GGTCTC 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 118
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstSFI CTRYAG 1 cut(s) 39
BstV1I GCAGC 1 cut(s) 25
BtsIMutI CAGTG 3 cut(s) 101, 114, 156
CviAII CATG 3 cut(s) 139, 164, 171
CviJI RGCY 4 cut(s) 22, 38, 50, 63
CviKI_1 RGCY 4 cut(s) 22, 38, 50, 63
DdeI CTNAG 1 cut(s) 117
Eco31I GGTCTC 1 cut(s) 118
Eco57I CTGAAG 1 cut(s) 44
FaeI CATG 3 cut(s) 142, 167, 174
FaiI YATR 4 cut(s) 66, 140, 165, 172
FalI AAGNNNNNCTT 3 cut(s) 17, 49, 213
FatI CATG 3 cut(s) 138, 163, 170
Fnu4HI GCNGC 1 cut(s) 39
Fsp4HI GCNGC 1 cut(s) 39
FspBI CTAG 1 cut(s) 135
GluI GCNGC 1 cut(s) 39
Hin1II CATG 3 cut(s) 142, 167, 174
HinfI GANTC 3 cut(s) 4, 74, 83
HphI GGTGA 1 cut(s) 103
HpyAV CCTTC 2 cut(s) 19, 163
HpyCH4V TGCA 2 cut(s) 41, 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 3 cut(s) 142, 167, 174
LpnPI CCDG 1 cut(s) 143
Lsp1109I GCAGC 1 cut(s) 25
MaeI CTAG 1 cut(s) 135
MaeIII GTNAC 2 cut(s) 13, 99
MluCI AATT 3 cut(s) 44, 107, 210
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 1 cut(s) 218
MslI CAYNNNNRTG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 47
NlaIII CATG 3 cut(s) 142, 167, 174
NmuCI GTSAC 2 cut(s) 13, 99
PfeI GAWTC 2 cut(s) 74, 83
PkrI GCNGC 1 cut(s) 40
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
PstI CTGCAG 1 cut(s) 43
RseI CAYNNNNRTG 1 cut(s) 119
SatI GCNGC 1 cut(s) 39
SchI GAGTC 1 cut(s) 13
SetI ASST 4 cut(s) 12, 24, 65, 229
SfcI CTRYAG 1 cut(s) 39
SgeI CNNG 8 cut(s) 20, 46, 63, 142, 147, 151, 176, 183
SmiMI CAYNNNNRTG 1 cut(s) 119
Sse9I AATT 3 cut(s) 44, 107, 210
SspMI CTAG 1 cut(s) 135
TaqI TCGA 2 cut(s) 52, 77
TasI AATT 3 cut(s) 44, 107, 210
TfiI GAWTC 2 cut(s) 74, 83
TscAI CASTG 3 cut(s) 108, 121, 163
TseFI GTSAC 2 cut(s) 13, 99
TseI GCWGC 1 cut(s) 38
Tsp45I GTSAC 2 cut(s) 13, 99
TspRI CASTG 3 cut(s) 108, 121, 163
XapI RAATTY 2 cut(s) 107, 210
XspI CTAG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.