Rh2CG530300

plastid-lipid-associated protein 14, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
N/A
Physical Location & Seq
Reverse (-)
70581018 .. 70586942
5925 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG530300.1

Sequence Viewer

Length: 204 bp
ATGGATACGCACAACCAAGACATTGACCTCCAACCTTGGAGGGTATTCATGCATTGGACAAGGAATTTGTTAAGAGGGGTGGAAGATGACACAGTTGGAGGACCTGCAGTTTCTCACCAATTACAGATGATTAGATTATCAATGAAAAATCTGTTCATTGTAATCGCAGCCTTGAGGCTTAGCGGTGGAATACGGGAAATGTAA

Protein Analysis

67

Amino Acids

7.73

Weight (kDa)

6.82

Isoelectric Point (pI)

40.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 112
AciI CCGC 1 cut(s) 183
AcsI RAATTY 1 cut(s) 64
ApeKI GCWGC 1 cut(s) 167
ApoI RAATTY 1 cut(s) 64
ArsI GACNNNNNNTTYG 2 cut(s) 49, 81
AspS9I GGNCC 1 cut(s) 101
AsuHPI GGTGA 1 cut(s) 107
AvaII GGWCC 1 cut(s) 101
BbvI GCAGC 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 105
BfuAI ACCTGC 1 cut(s) 112
BisI GCNGC 1 cut(s) 168
BlpI GCTNAGC 1 cut(s) 179
BlsI GCNGC 1 cut(s) 169
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
Bpu1102I GCTNAGC 1 cut(s) 179
BpuEI CTTGAG 1 cut(s) 193
BsaJI CCNNGG 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 35
BseXI GCAGC 1 cut(s) 179
Bsp1720I GCTNAGC 1 cut(s) 179
BspACI CCGC 1 cut(s) 183
BspMAI CTGCAG 1 cut(s) 109
BspMI ACCTGC 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 35
BssT1I CCWWGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 94
BstDEI CTNAG 1 cut(s) 179
BstSFI CTRYAG 1 cut(s) 105
BstV1I GCAGC 1 cut(s) 179
BveI ACCTGC 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 101
CviAII CATG 1 cut(s) 49
CviJI RGCY 2 cut(s) 170, 178
CviKI_1 RGCY 2 cut(s) 170, 178
DdeI CTNAG 1 cut(s) 179
Eco130I CCWWGG 1 cut(s) 35
Eco47I GGWCC 1 cut(s) 101
EcoO109I RGGNCCY 1 cut(s) 101
EcoT14I CCWWGG 1 cut(s) 35
EcoT22I ATGCAT 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 35
FaeI CATG 1 cut(s) 52
FaiI YATR 1 cut(s) 50
FatI CATG 1 cut(s) 48
Fnu4HI GCNGC 1 cut(s) 168
Fsp4HI GCNGC 1 cut(s) 168
GluI GCNGC 1 cut(s) 168
Hin1II CATG 1 cut(s) 52
HphI GGTGA 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 94
HpyCH4V TGCA 2 cut(s) 52, 107
HpyF3I CTNAG 1 cut(s) 179
Hsp92II CATG 1 cut(s) 52
LpnPI CCDG 1 cut(s) 117
Lsp1109I GCAGC 1 cut(s) 179
MboII GAAGA 1 cut(s) 95
MluCI AATT 2 cut(s) 64, 119
MmeI TCCRAC 2 cut(s) 55, 76
MnlI CCTC 5 cut(s) 33, 38, 68, 92, 168
Mph1103I ATGCAT 1 cut(s) 54
MseI TTAA 1 cut(s) 71
NlaIII CATG 1 cut(s) 52
NsiI ATGCAT 1 cut(s) 54
PkrI GCNGC 1 cut(s) 169
PpuMI RGGWCCY 1 cut(s) 101
Psp5II RGGWCCY 1 cut(s) 101
PspPI GGNCC 1 cut(s) 101
PspPPI RGGWCCY 1 cut(s) 101
PstI CTGCAG 1 cut(s) 109
SaqAI TTAA 1 cut(s) 71
SatI GCNGC 1 cut(s) 168
Sau96I GGNCC 1 cut(s) 101
SetI ASST 3 cut(s) 30, 37, 106
SfcI CTRYAG 1 cut(s) 105
SgeI CNNG 6 cut(s) 29, 48, 61, 72, 116, 184
SinI GGWCC 1 cut(s) 101
SmlI CTYRAG 1 cut(s) 172
SmoI CTYRAG 1 cut(s) 172
Sse9I AATT 2 cut(s) 64, 119
SsiI CCGC 1 cut(s) 183
StyI CCWWGG 1 cut(s) 35
TaaI ACNGT 1 cut(s) 94
TasI AATT 2 cut(s) 64, 119
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TseI GCWGC 1 cut(s) 167
TspDTI ATGAA 3 cut(s) 37, 145, 158
VpaK11BI GGWCC 1 cut(s) 101
XapI RAATTY 1 cut(s) 64
Zsp2I ATGCAT 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.