Rh2DG007200

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
N/A
Physical Location & Seq
Forward (+)
430331 .. 430645
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG007200.1

Sequence Viewer

Length: 315 bp
ATGGATATTCCTGACTACGAGACTATGGATAGCAGAGCGACGCGTCTTTGTGCCAGAATACAAGGCAAAAGGATTCTTGTCATTTTAGATGATGTTCAAGAAATAATTGATTTGGAGGTTGTGGGACTTCCCGATCTTCCAACTTTGAAGATATTGTTGACATCTAGAAGTCGACTTGTTCTATCTTCTGACATGCGTACGCATAAAGAGTTTCGCTTGGACGTTTTAGATAAAGAAGAGGCTTGGAGTCTTTTTGAGAAGATGGCTGGTGATGTTGTCAAACAGAATGGTCCTATACTCCTATACGAGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.96

Weight (kDa)

4.82

Isoelectric Point (pI)

45.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 11 - 90 3.3e-14 NB-ARC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 172
AccII CGCG 1 cut(s) 43
AfaI GTAC 1 cut(s) 199
AflIII ACRYGT 1 cut(s) 41
AgsI TTSAA 2 cut(s) 98, 148
Alw26I GTCTC 1 cut(s) 14
AspS9I GGNCC 1 cut(s) 290
AsuHPI GGTGA 1 cut(s) 281
AvaII GGWCC 1 cut(s) 290
BccI CCATC 1 cut(s) 256
BcoDI GTCTC 1 cut(s) 14
BfaI CTAG 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 290
BmgT120I GGNCC 1 cut(s) 290
Bsh1236I CGCG 1 cut(s) 43
BsiWI CGTACG 1 cut(s) 197
BslFI GGGAC 1 cut(s) 138
BsmAI GTCTC 1 cut(s) 14
BsmFI GGGAC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 133
BspFNI CGCG 1 cut(s) 43
BssMI GATC 1 cut(s) 133
Bst6I CTCTTC 1 cut(s) 231
BstFNI CGCG 1 cut(s) 43
BstKTI GATC 1 cut(s) 136
BstMAI GTCTC 1 cut(s) 14
BstMBI GATC 1 cut(s) 133
BstNSI RCATGY 1 cut(s) 196
BstUI CGCG 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 290
CseI GACGC 2 cut(s) 32, 49
Csp6I GTAC 1 cut(s) 198
CviAII CATG 1 cut(s) 193
CviJI RGCY 2 cut(s) 242, 266
CviKI_1 RGCY 2 cut(s) 242, 266
CviQI GTAC 1 cut(s) 198
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
Eam1104I CTCTTC 1 cut(s) 231
EarI CTCTTC 1 cut(s) 231
Eco47I GGWCC 1 cut(s) 290
FaeI CATG 1 cut(s) 196
FaiI YATR 6 cut(s) 26, 194, 204, 296, 304, 313
FaqI GGGAC 1 cut(s) 138
FatI CATG 1 cut(s) 192
FblI GTMKAC 1 cut(s) 172
FspBI CTAG 1 cut(s) 165
HgaI GACGC 2 cut(s) 32, 49
Hin1II CATG 1 cut(s) 196
HincII GTYRAC 2 cut(s) 159, 173
HindII GTYRAC 2 cut(s) 159, 173
HinfI GANTC 2 cut(s) 73, 247
HphI GGTGA 1 cut(s) 281
Hpy166II GTNNAC 2 cut(s) 159, 173
Hpy188I TCNGA 1 cut(s) 190
Hpy188III TCNNGA 4 cut(s) 11, 98, 131, 165
Hpy8I GTNNAC 2 cut(s) 159, 173
Hpy99I CGWCG 1 cut(s) 43
HpyCH4IV ACGT 1 cut(s) 222
HpySE526I ACGT 1 cut(s) 222
Hsp92II CATG 1 cut(s) 196
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 3 cut(s) 24, 67, 252
MaeI CTAG 1 cut(s) 165
MaeII ACGT 1 cut(s) 222
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 5 cut(s) 128, 160, 177, 248, 271
MluCI AATT 1 cut(s) 105
MluI ACGCGT 1 cut(s) 41
MlyI GAGTC 1 cut(s) 256
MmeI TCCRAC 1 cut(s) 164
MnlI CCTC 2 cut(s) 109, 232
MvnI CGCG 1 cut(s) 43
NdeII GATC 1 cut(s) 133
NlaIII CATG 1 cut(s) 196
NspI RCATGY 1 cut(s) 196
PfeI GAWTC 1 cut(s) 73
Pfl23II CGTACG 1 cut(s) 197
PleI GAGTC 1 cut(s) 255
PpsI GAGTC 1 cut(s) 255
PspLI CGTACG 1 cut(s) 197
PspPI GGNCC 1 cut(s) 290
RsaI GTAC 1 cut(s) 199
RsaNI GTAC 1 cut(s) 198
SalI GTCGAC 1 cut(s) 171
Sau3AI GATC 1 cut(s) 133
Sau96I GGNCC 1 cut(s) 290
SchI GAGTC 1 cut(s) 256
SetI ASST 2 cut(s) 120, 225
SinI GGWCC 1 cut(s) 290
Sse9I AATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 165
TaiI ACGT 1 cut(s) 225
TaqI TCGA 1 cut(s) 172
TasI AATT 1 cut(s) 105
TfiI GAWTC 1 cut(s) 73
VpaK11BI GGWCC 1 cut(s) 290
XbaI TCTAGA 1 cut(s) 164
XceI RCATGY 1 cut(s) 196
XmiI GTMKAC 1 cut(s) 172
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.