Rh2DG231200

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
N/A
Physical Location & Seq
Forward (+)
22971469 .. 22972103
635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG231200.1

Sequence Viewer

Length: 198 bp
ATGGCTACTGATATGGCCAGGCTTAAGGAGTACTCAGCCGAGGAGATTGTATTGGCTACTGATAATTTTTCTTGGCGGTTGAGATCAGAGTCTGTAGGAATTTGGGGCAGTGTTTATAAAGGCTATGTTGACAATGAAGCAGTTTCCATCAAATTCCTCACCTCCCCCCAAGAACATGTTTTTGAATCTAGGGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.4

Weight (kDa)

4.94

Isoelectric Point (pI)

36.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 117
AciI CCGC 1 cut(s) 76
AcoI YGGCCR 1 cut(s) 15
AcsI RAATTY 2 cut(s) 99, 152
AfaI GTAC 1 cut(s) 32
AflII CTTAAG 1 cut(s) 23
AflIII ACRYGT 1 cut(s) 175
AgsI TTSAA 1 cut(s) 185
AjnI CCWGG 1 cut(s) 17
AlwNI CAGNNNCTG 1 cut(s) 92
AoxI GGCC 1 cut(s) 15
ApoI RAATTY 2 cut(s) 99, 152
AsuHPI GGTGA 1 cut(s) 151
BalI TGGCCA 1 cut(s) 17
BccI CCATC 1 cut(s) 155
BciT130I CCWGG 1 cut(s) 19
BfaI CTAG 1 cut(s) 189
BfmI CTRYAG 1 cut(s) 93
BfrI CTTAAG 1 cut(s) 23
BmcAI AGTACT 1 cut(s) 32
Bme1390I CCNGG 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 39
BseBI CCWGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 39
BseMII CTCAG 1 cut(s) 48
BseRI GAGGAG 1 cut(s) 56
BshFI GGCC 1 cut(s) 17
BsnI GGCC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 83
BspACI CCGC 1 cut(s) 76
BspANI GGCC 1 cut(s) 17
BspCNI CTCAG 1 cut(s) 47
BspTI CTTAAG 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 39
BssMI GATC 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 19
BstAFI CTTAAG 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 34
BstKTI GATC 1 cut(s) 86
BstMBI GATC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 19
BstNSI RCATGY 1 cut(s) 179
BstSCI CCNGG 1 cut(s) 17
BstSFI CTRYAG 1 cut(s) 93
BsuRI GGCC 1 cut(s) 17
BtsI GCAGTG 1 cut(s) 115
BtsIMutI CAGTG 1 cut(s) 115
CaiI CAGNNNCTG 1 cut(s) 92
Csp6I GTAC 1 cut(s) 31
CviAII CATG 1 cut(s) 176
CviJI RGCY 7 cut(s) 5, 17, 22, 38, 56, 123, 195
CviKI_1 RGCY 7 cut(s) 5, 17, 22, 38, 56, 123, 195
CviQI GTAC 1 cut(s) 31
DdeI CTNAG 1 cut(s) 34
DpnI GATC 1 cut(s) 85
DpnII GATC 1 cut(s) 83
EaeI YGGCCR 1 cut(s) 15
EcoRII CCWGG 1 cut(s) 17
FaeI CATG 1 cut(s) 179
FaiI YATR 4 cut(s) 14, 117, 126, 177
FatI CATG 1 cut(s) 175
FspBI CTAG 1 cut(s) 189
HaeIII GGCC 1 cut(s) 17
Hin1II CATG 1 cut(s) 179
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HinfI GANTC 2 cut(s) 89, 185
HphI GGTGA 1 cut(s) 151
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 34
Hsp92II CATG 1 cut(s) 179
Kzo9I GATC 1 cut(s) 83
LpnPI CCDG 2 cut(s) 4, 31
MaeI CTAG 1 cut(s) 189
MalI GATC 1 cut(s) 85
MboI GATC 1 cut(s) 83
MlsI TGGCCA 1 cut(s) 17
MluCI AATT 3 cut(s) 64, 99, 152
MluNI TGGCCA 1 cut(s) 17
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 3 cut(s) 34, 167, 172
Mox20I TGGCCA 1 cut(s) 17
MscI TGGCCA 1 cut(s) 17
MseI TTAA 1 cut(s) 24
Msp20I TGGCCA 1 cut(s) 17
MspCI CTTAAG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 19
MvaI CCWGG 1 cut(s) 19
NdeII GATC 1 cut(s) 83
NlaIII CATG 1 cut(s) 179
NmeAIII GCCGAG 1 cut(s) 64
NspI RCATGY 1 cut(s) 179
PciI ACATGT 1 cut(s) 175
PfeI GAWTC 1 cut(s) 185
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
PscI ACATGT 1 cut(s) 175
PsiI TTATAA 1 cut(s) 117
Psp6I CCWGG 1 cut(s) 17
PspGI CCWGG 1 cut(s) 17
PstNI CAGNNNCTG 1 cut(s) 92
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
SaqAI TTAA 1 cut(s) 24
Sau3AI GATC 1 cut(s) 83
ScaI AGTACT 1 cut(s) 32
SchI GAGTC 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 19
SetI ASST 1 cut(s) 164
SfcI CTRYAG 1 cut(s) 93
SgeI CNNG 6 cut(s) 30, 31, 52, 84, 182, 188
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
Sse9I AATT 3 cut(s) 64, 99, 152
SsiI CCGC 1 cut(s) 76
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 1 cut(s) 17
TasI AATT 3 cut(s) 64, 99, 152
TatI WGTACW 1 cut(s) 30
TfiI GAWTC 1 cut(s) 185
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TscAI CASTG 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 150
TspRI CASTG 1 cut(s) 115
Vha464I CTTAAG 1 cut(s) 23
XapI RAATTY 2 cut(s) 99, 152
XceI RCATGY 1 cut(s) 179
XspI CTAG 1 cut(s) 189
ZrmI AGTACT 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.