Rh3AG063900
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
N/A
Physical Location & Seq
Forward (+)
4413158 .. 4415212
2055 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG063900.1

Sequence Viewer

Length: 240 bp
ATGATCAGCCTAGCAGTTCATCGCAACCTTCTCCAGCTTTATGGGTTTTGCATCACTCCAACAGAAAGACTTCTAGTTTACCCATACATGTCCAATGGCAGTGTGGCTTCTCGTGTCAAAGGTGGCATGGAAGGGTTCCTTTCACTAGCCTCCCAATTACACGCCACAAAATTAGTTGCTTCAGATGGTAATGACTACTTTGCACATAACCACACCGACAATGATATGGTAGCAAATTAA

Protein Analysis

79

Amino Acids

8.67

Weight (kDa)

6.37

Isoelectric Point (pI)

30.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 165
AflIII ACRYGT 1 cut(s) 87
AluBI AGCT 1 cut(s) 37
AluI AGCT 1 cut(s) 37
Asp700I GAANNNNTTC 1 cut(s) 69
BauI CACGAG 1 cut(s) 111
BccI CCATC 1 cut(s) 179
BclI TGATCA 1 cut(s) 3
BfaI CTAG 3 cut(s) 11, 74, 146
BmiI GGNNCC 1 cut(s) 137
BmsI GCATC 1 cut(s) 60
BpmI CTGGAG 1 cut(s) 17
Bsp143I GATC 1 cut(s) 3
BspLI GGNNCC 1 cut(s) 137
BssMI GATC 1 cut(s) 3
BssSI CACGAG 1 cut(s) 111
Bst2BI CACGAG 1 cut(s) 111
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstNSI RCATGY 1 cut(s) 91
BstXI CCANNNNNNTGG 1 cut(s) 41
BtgZI GCGATG 1 cut(s) 5
BtsI GCAGTG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 106
CviAII CATG 2 cut(s) 88, 127
CviJI RGCY 4 cut(s) 9, 37, 107, 149
CviKI_1 RGCY 4 cut(s) 9, 37, 107, 149
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco57I CTGAAG 1 cut(s) 165
FaeI CATG 2 cut(s) 91, 130
FaiI YATR 6 cut(s) 42, 85, 89, 128, 207, 227
FalI AAGNNNNNCTT 2 cut(s) 123, 155
FatI CATG 2 cut(s) 87, 126
FbaI TGATCA 1 cut(s) 3
FspBI CTAG 3 cut(s) 11, 74, 146
GsuI CTGGAG 1 cut(s) 17
Hin1II CATG 2 cut(s) 91, 130
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 184
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 2 cut(s) 38, 125
HpyCH4V TGCA 2 cut(s) 51, 203
Hsp92II CATG 2 cut(s) 91, 130
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 1 cut(s) 47
LweI GCATC 1 cut(s) 60
MaeI CTAG 3 cut(s) 11, 74, 146
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MluCI AATT 3 cut(s) 155, 170, 235
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 1 cut(s) 160
MroXI GAANNNNTTC 1 cut(s) 69
MseI TTAA 1 cut(s) 238
NdeII GATC 1 cut(s) 3
NlaIII CATG 2 cut(s) 91, 130
NlaIV GGNNCC 1 cut(s) 137
NspI RCATGY 1 cut(s) 91
PciI ACATGT 1 cut(s) 87
PdmI GAANNNNTTC 1 cut(s) 69
PscI ACATGT 1 cut(s) 87
PspN4I GGNNCC 1 cut(s) 137
SaqAI TTAA 1 cut(s) 238
Sau3AI GATC 1 cut(s) 3
SetI ASST 3 cut(s) 30, 39, 124
SfaNI GCATC 1 cut(s) 60
SgeI CNNG 9 cut(s) 23, 46, 86, 100, 123, 125, 139, 158, 173
Sse9I AATT 3 cut(s) 155, 170, 235
SspMI CTAG 3 cut(s) 11, 74, 146
TasI AATT 3 cut(s) 155, 170, 235
Tru1I TTAA 1 cut(s) 238
Tru9I TTAA 1 cut(s) 238
TscAI CASTG 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 8
TspRI CASTG 1 cut(s) 106
XceI RCATGY 1 cut(s) 91
XcmI CCANNNNNNNNNTGG 1 cut(s) 100
XmnI GAANNNNTTC 1 cut(s) 69
XspI CTAG 3 cut(s) 11, 74, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.