Rh3BG106300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
N/A
Physical Location & Seq
Forward (+)
8496310 .. 8501397
5088 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG106300.1

Sequence Viewer

Length: 201 bp
ATGAGGGGGAGGCCAGATCAGATGGAAGTGGCAGAATACTTGTTGAAGCACGGTGAGGTTTTGGATAAGGTGACAGTTCATCGGACTTCCAAATGTATCTCTTCAAAAAAAGAGAAGAAATTATGGCGGGGATTGAAGAAGTTGCCGAGGTGTTCGAAGACATGTCAAATTGAATTTCCATGCCTCTCTGTCACAGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.62

Weight (kDa)

9.7

Isoelectric Point (pI)

13.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 173
AflIII ACRYGT 1 cut(s) 161
AgsI TTSAA 4 cut(s) 46, 105, 136, 173
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 173
AsuHPI GGTGA 2 cut(s) 65, 82
AsuII TTCGAA 1 cut(s) 155
BbsI GAAGAC 1 cut(s) 164
BccI CCATC 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 164
Bpu14I TTCGAA 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 146
BseDI CCNNGG 1 cut(s) 146
BshFI GGCC 1 cut(s) 13
BsnI GGCC 1 cut(s) 13
Bsp119I TTCGAA 1 cut(s) 155
Bsp143I GATC 1 cut(s) 16
BspACI CCGC 1 cut(s) 127
BspANI GGCC 1 cut(s) 13
BspT104I TTCGAA 1 cut(s) 155
BssECI CCNNGG 1 cut(s) 146
BssMI GATC 1 cut(s) 16
Bst4CI ACNGT 2 cut(s) 53, 76
Bst6I CTCTTC 1 cut(s) 106
BstBI TTCGAA 1 cut(s) 155
BstKTI GATC 1 cut(s) 19
BstMBI GATC 1 cut(s) 16
BstNSI RCATGY 1 cut(s) 165
BstV2I GAAGAC 1 cut(s) 164
BsuRI GGCC 1 cut(s) 13
CviAII CATG 2 cut(s) 162, 180
CviJI RGCY 1 cut(s) 13
CviKI_1 RGCY 1 cut(s) 13
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
Eam1104I CTCTTC 1 cut(s) 106
EarI CTCTTC 1 cut(s) 106
FaeI CATG 2 cut(s) 165, 183
FaiI YATR 4 cut(s) 124, 163, 181, 199
FatI CATG 2 cut(s) 161, 179
FauI CCCGC 1 cut(s) 120
HaeIII GGCC 1 cut(s) 13
Hin1II CATG 2 cut(s) 165, 183
HphI GGTGA 2 cut(s) 65, 82
Hpy188I TCNGA 2 cut(s) 21, 84
HpyCH4III ACNGT 2 cut(s) 53, 76
Hsp92II CATG 2 cut(s) 165, 183
Kzo9I GATC 1 cut(s) 16
LpnPI CCDG 1 cut(s) 27
MaeIII GTNAC 2 cut(s) 70, 190
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MboII GAAGA 4 cut(s) 93, 127, 148, 169
MluCI AATT 3 cut(s) 119, 168, 173
MnlI CCTC 4 cut(s) 3, 49, 141, 194
NdeII GATC 1 cut(s) 16
NlaIII CATG 2 cut(s) 165, 183
NmeAIII GCCGAG 1 cut(s) 171
NmuCI GTSAC 2 cut(s) 70, 190
NspI RCATGY 1 cut(s) 165
NspV TTCGAA 1 cut(s) 155
PciI ACATGT 1 cut(s) 161
PscI ACATGT 1 cut(s) 161
Sau3AI GATC 1 cut(s) 16
SetI ASST 3 cut(s) 60, 72, 152
SfuI TTCGAA 1 cut(s) 155
SgeI CNNG 7 cut(s) 26, 52, 62, 140, 159, 174, 192
Sse9I AATT 3 cut(s) 119, 168, 173
SsiI CCGC 1 cut(s) 127
TaaI ACNGT 2 cut(s) 53, 76
TaqI TCGA 1 cut(s) 155
TasI AATT 3 cut(s) 119, 168, 173
TseFI GTSAC 2 cut(s) 70, 190
Tsp45I GTSAC 2 cut(s) 70, 190
TspDTI ATGAA 1 cut(s) 68
XapI RAATTY 1 cut(s) 173
XceI RCATGY 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.