Rh3DG309500

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
N/A
Physical Location & Seq
Forward (+)
33212788 .. 33225813
13026 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG309500.1

Sequence Viewer

Length: 222 bp
ATGCCCTTCCATCTAAGTCATTTTACTTTTCTCTTGGTGGTGTCAAGTGAGATTGTTGGAGAAGAAGCTTCCACCACTTCTGGCCACATTATGCTACTTGAGGAACAACCCATTACTCATTCTTCTGCAAAAATGGAAGCTCAATCTCCAGATTTGAGGGTAAAAAACGTGGTGGGTAGTGTCTCAAATGTCGCGCATCTTCTCCACATTACCGAGATGTAA

Protein Analysis

73

Amino Acids

8.0

Weight (kDa)

5.52

Isoelectric Point (pI)

70.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 194
AcoI YGGCCR 1 cut(s) 82
AluBI AGCT 2 cut(s) 68, 140
AluI AGCT 2 cut(s) 68, 140
Alw26I GTCTC 1 cut(s) 187
AoxI GGCC 1 cut(s) 82
AspLEI GCGC 1 cut(s) 196
BalI TGGCCA 1 cut(s) 84
BccI CCATC 1 cut(s) 18
BcoDI GTCTC 1 cut(s) 187
BmsI GCATC 1 cut(s) 205
BpmI CTGGAG 1 cut(s) 132
BpuEI CTTGAG 1 cut(s) 119
Bsh1236I CGCG 1 cut(s) 194
BshFI GGCC 1 cut(s) 84
BsmAI GTCTC 1 cut(s) 187
BsnI GGCC 1 cut(s) 84
BspANI GGCC 1 cut(s) 84
BspFNI CGCG 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 14
BstFNI CGCG 1 cut(s) 194
BstHHI GCGC 1 cut(s) 196
BstMAI GTCTC 1 cut(s) 187
BstUI CGCG 1 cut(s) 194
BsuRI GGCC 1 cut(s) 84
CfoI GCGC 1 cut(s) 196
CviJI RGCY 3 cut(s) 68, 84, 140
CviKI_1 RGCY 3 cut(s) 68, 84, 140
DdeI CTNAG 1 cut(s) 14
EaeI YGGCCR 1 cut(s) 82
FaiI YATR 1 cut(s) 92
GlaI GCGC 1 cut(s) 195
GsuI CTGGAG 1 cut(s) 132
HaeIII GGCC 1 cut(s) 84
HhaI GCGC 1 cut(s) 196
Hin6I GCGC 1 cut(s) 194
HinP1I GCGC 1 cut(s) 194
HindIII AAGCTT 1 cut(s) 66
Hpy188III TCNNGA 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 16
HpyCH4IV ACGT 1 cut(s) 168
HpyCH4V TGCA 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 14
HpySE526I ACGT 1 cut(s) 168
HspAI GCGC 1 cut(s) 194
LpnPI CCDG 2 cut(s) 66, 162
LweI GCATC 1 cut(s) 205
MaeII ACGT 1 cut(s) 168
MboII GAAGA 3 cut(s) 74, 114, 191
MlsI TGGCCA 1 cut(s) 84
MluNI TGGCCA 1 cut(s) 84
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 2 cut(s) 94, 150
Mox20I TGGCCA 1 cut(s) 84
MscI TGGCCA 1 cut(s) 84
Msp20I TGGCCA 1 cut(s) 84
MvnI CGCG 1 cut(s) 194
SetI ASST 3 cut(s) 70, 142, 171
SfaNI GCATC 1 cut(s) 205
SgeI CNNG 7 cut(s) 46, 57, 93, 110, 161, 181, 205
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
TaiI ACGT 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.