Rh4AG060100

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
N/A
Physical Location & Seq
Reverse (-)
12528216 .. 12537892
9677 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG060100.1

Sequence Viewer

Length: 186 bp
ATGTTCACGTTTTTAGTTATCAAGATCACTTTAGTGGACAAAGAAGATCTGCATAACCTAAGAATTGATGGGCTTTCAAATTTCGTAGGCAAATTGACCTGTCTTAGGTACGTCGACCTCTTTGGTAATGTTAGTAAGAACACTCCTTCCTTCTATCAGCAATCTGCAGAATCTACAGTCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.92

Weight (kDa)

6.52

Isoelectric Point (pI)

33.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 114
AcsI RAATTY 1 cut(s) 79
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 105
AgsI TTSAA 1 cut(s) 78
AleI CACNNNNGTG 1 cut(s) 32
AloI GAACNNNNNNTCC 2 cut(s) 131, 163
ApoI RAATTY 1 cut(s) 79
BccI CCATC 1 cut(s) 62
BfmI CTRYAG 2 cut(s) 165, 174
BglII AGATCT 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 105
BslFI GGGAC 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 105
BsmFI GGGAC 1 cut(s) 164
Bsp143I GATC 2 cut(s) 24, 46
BspMAI CTGCAG 1 cut(s) 169
BssMI GATC 2 cut(s) 24, 46
Bst4CI ACNGT 1 cut(s) 178
BstDEI CTNAG 2 cut(s) 59, 104
BstENI CCTNNNNNAGG 1 cut(s) 103
BstKTI GATC 2 cut(s) 27, 49
BstMBI GATC 2 cut(s) 24, 46
BstSFI CTRYAG 2 cut(s) 165, 174
BstX2I RGATCY 1 cut(s) 46
BstYI RGATCY 1 cut(s) 46
Csp6I GTAC 1 cut(s) 109
CviJI RGCY 1 cut(s) 73
CviKI_1 RGCY 1 cut(s) 73
CviQI GTAC 1 cut(s) 109
DdeI CTNAG 2 cut(s) 59, 104
DpnI GATC 2 cut(s) 26, 48
DpnII GATC 2 cut(s) 24, 46
EcoNI CCTNNNNNAGG 1 cut(s) 103
FaiI YATR 1 cut(s) 54
FaqI GGGAC 1 cut(s) 164
FblI GTMKAC 1 cut(s) 114
HincII GTYRAC 1 cut(s) 115
HindII GTYRAC 1 cut(s) 115
HinfI GANTC 1 cut(s) 170
Hpy166II GTNNAC 3 cut(s) 6, 37, 115
Hpy188III TCNNGA 1 cut(s) 22
Hpy8I GTNNAC 3 cut(s) 6, 37, 115
Hpy99I CGWCG 1 cut(s) 116
HpyAV CCTTC 2 cut(s) 156, 160
HpyCH4III ACNGT 1 cut(s) 178
HpyCH4IV ACGT 2 cut(s) 8, 111
HpyCH4V TGCA 2 cut(s) 52, 167
HpyF3I CTNAG 2 cut(s) 59, 104
HpySE526I ACGT 2 cut(s) 8, 111
Kzo9I GATC 2 cut(s) 24, 46
LpnPI CCDG 1 cut(s) 112
MaeII ACGT 2 cut(s) 8, 111
MalI GATC 2 cut(s) 26, 48
MboI GATC 2 cut(s) 24, 46
MboII GAAGA 1 cut(s) 56
MflI RGATCY 1 cut(s) 46
MluCI AATT 3 cut(s) 63, 79, 92
MnlI CCTC 1 cut(s) 128
MseI TTAA 1 cut(s) 184
MslI CAYNNNNRTG 1 cut(s) 32
NdeII GATC 2 cut(s) 24, 46
OliI CACNNNNGTG 1 cut(s) 32
PfeI GAWTC 1 cut(s) 170
PstI CTGCAG 1 cut(s) 169
PsuI RGATCY 1 cut(s) 46
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 32
SalI GTCGAC 1 cut(s) 113
SaqAI TTAA 1 cut(s) 184
Sau3AI GATC 2 cut(s) 24, 46
SetI ASST 6 cut(s) 11, 60, 101, 110, 114, 120
SfcI CTRYAG 2 cut(s) 165, 174
SgeI CNNG 3 cut(s) 19, 34, 111
SmiMI CAYNNNNRTG 1 cut(s) 32
Sse9I AATT 3 cut(s) 63, 79, 92
TaaI ACNGT 1 cut(s) 178
TaiI ACGT 2 cut(s) 11, 114
TaqI TCGA 1 cut(s) 114
TasI AATT 3 cut(s) 63, 79, 92
TfiI GAWTC 1 cut(s) 170
Tru1I TTAA 1 cut(s) 184
Tru9I TTAA 1 cut(s) 184
XagI CCTNNNNNAGG 1 cut(s) 103
XapI RAATTY 1 cut(s) 79
XmiI GTMKAC 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.