Rh4BG391500

receptor-like protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
N/A
Physical Location & Seq
Reverse (-)
54416177 .. 54416638
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG391500.1

Sequence Viewer

Length: 462 bp
ATGCTGACAGGCAGAAGATCTATGGACAAAAATCGACCTAATGGTGAACATAACCTTGTGGAATGGGCTCGACCACATCTAGGAGATAGAAGAAGATTCTACCGATTAATAGACCCTCGGCTGGAAGGTCACTTTTCAATAAAAGGTGTACAGAAAGCTGCACAACTAGCTGCCCATTGCCTTAGTCGAGATCCAAAAGCAAGGCCCCTAATGAGCGATGTTGTTGAAGCATTAAAGCCATTGCCAAACCTTAAGGATATGGCAAGCTCATCATATTATTTCCAGACCATGCAAGGTGACCGAGTTGGATCCAGTCCGAATACCAGAAATGGTGTCAGAACACAAGGAGGATTGCTTACAAGGAATGGGCACAGGAGCCTATCAATACCAAATGGCTCCCATGCTTCTCCATATCACCATCAATTTCCCCATCCATCTCCGAAACCTAATGGAAAAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

153

Amino Acids

17.17

Weight (kDa)

10.75

Isoelectric Point (pI)

41.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 185, 303, 316
AfaI GTAC 1 cut(s) 150
AfiI CCNNNNNNNGG 2 cut(s) 80, 121
AflII CTTAAG 1 cut(s) 251
AgsI TTSAA 2 cut(s) 138, 227
AluBI AGCT 3 cut(s) 158, 170, 267
AluI AGCT 3 cut(s) 158, 170, 267
AlwI GGATC 3 cut(s) 185, 303, 316
AoxI GGCC 1 cut(s) 203
ApeKI GCWGC 2 cut(s) 158, 170
AseI ATTAAT 1 cut(s) 107
AspS9I GGNCC 1 cut(s) 204
AsuHPI GGTGA 3 cut(s) 56, 308, 407
BaeGI GKGCMC 1 cut(s) 372
BamHI GGATCC 1 cut(s) 308
BanII GRGCYC 1 cut(s) 70
BbvI GCAGC 2 cut(s) 145, 157
BccI CCATC 3 cut(s) 426, 438, 442
BfaI CTAG 2 cut(s) 80, 167
BfrI CTTAAG 1 cut(s) 251
BglII AGATCT 1 cut(s) 17
BisI GCNGC 2 cut(s) 159, 171
BlsI GCNGC 2 cut(s) 160, 172
BmgT120I GGNCC 1 cut(s) 204
BmiI GGNNCC 4 cut(s) 206, 310, 377, 397
BsaJI CCNNGG 1 cut(s) 116
Bsc4I CCNNNNNNNGG 2 cut(s) 80, 121
Bse1I ACTGG 1 cut(s) 312
Bse3DI GCAATG 2 cut(s) 175, 239
BseDI CCNNGG 1 cut(s) 116
BseGI GGATG 1 cut(s) 430
BseLI CCNNNNNNNGG 2 cut(s) 80, 121
BseMI GCAATG 2 cut(s) 175, 239
BseNI ACTGG 1 cut(s) 312
BseSI GKGCMC 1 cut(s) 372
BseXI GCAGC 2 cut(s) 145, 157
BsgI GTGCAG 1 cut(s) 144
BshFI GGCC 1 cut(s) 205
BslI CCNNNNNNNGG 2 cut(s) 80, 121
BsnI GGCC 1 cut(s) 205
Bsp1286I GDGCHC 2 cut(s) 70, 372
Bsp1407I TGTACA 1 cut(s) 148
Bsp143I GATC 3 cut(s) 17, 190, 308
BspANI GGCC 1 cut(s) 205
BspLI GGNNCC 4 cut(s) 206, 310, 377, 397
BspPI GGATC 3 cut(s) 185, 303, 316
BspTI CTTAAG 1 cut(s) 251
BsrDI GCAATG 2 cut(s) 175, 239
BsrGI TGTACA 1 cut(s) 148
BsrI ACTGG 1 cut(s) 312
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 3 cut(s) 17, 190, 308
BstAFI CTTAAG 1 cut(s) 251
BstAUI TGTACA 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 265
BstDEI CTNAG 1 cut(s) 182
BstEII GGTNACC 1 cut(s) 296
BstF5I GGATG 1 cut(s) 430
BstKTI GATC 3 cut(s) 20, 193, 311
BstMBI GATC 3 cut(s) 17, 190, 308
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstPI GGTNACC 1 cut(s) 296
BstSLI GKGCMC 1 cut(s) 372
BstV1I GCAGC 2 cut(s) 145, 157
BstX2I RGATCY 3 cut(s) 17, 190, 308
BstYI RGATCY 3 cut(s) 17, 190, 308
BsuRI GGCC 1 cut(s) 205
BtgZI GCGATG 1 cut(s) 231
BtsCI GGATG 1 cut(s) 430
Cac8I GCNNGC 1 cut(s) 265
Cfr13I GGNCC 1 cut(s) 204
Csp6I GTAC 1 cut(s) 149
CviAII CATG 2 cut(s) 289, 401
CviJI RGCY 9 cut(s) 68, 121, 158, 170, 205, 238, 267, 378, 396
CviKI_1 RGCY 9 cut(s) 68, 121, 158, 170, 205, 238, 267, 378, 396
CviQI GTAC 1 cut(s) 149
DdeI CTNAG 1 cut(s) 182
DpnI GATC 3 cut(s) 19, 192, 310
DpnII GATC 3 cut(s) 17, 190, 308
Eco24I GRGCYC 1 cut(s) 70
Eco91I GGTNACC 1 cut(s) 296
EcoO109I RGGNCCY 1 cut(s) 204
EcoO65I GGTNACC 1 cut(s) 296
EcoT38I GRGCYC 1 cut(s) 70
FaeI CATG 2 cut(s) 292, 404
FaiI YATR 7 cut(s) 23, 51, 260, 274, 290, 402, 412
FatI CATG 2 cut(s) 288, 400
Fnu4HI GCNGC 2 cut(s) 159, 171
FokI GGATG 1 cut(s) 417
FriOI GRGCYC 1 cut(s) 70
Fsp4HI GCNGC 2 cut(s) 159, 171
FspBI CTAG 2 cut(s) 80, 167
GluI GCNGC 2 cut(s) 159, 171
HaeIII GGCC 1 cut(s) 205
Hin1II CATG 2 cut(s) 292, 404
HinfI GANTC 1 cut(s) 96
HphI GGTGA 3 cut(s) 56, 308, 407
Hpy166II GTNNAC 2 cut(s) 47, 149
Hpy188I TCNGA 3 cut(s) 318, 338, 441
Hpy188III TCNNGA 2 cut(s) 188, 283
Hpy8I GTNNAC 2 cut(s) 47, 149
HpyAV CCTTC 1 cut(s) 119
HpyCH4V TGCA 2 cut(s) 161, 292
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 182
Hsp92II CATG 2 cut(s) 292, 404
Kzo9I GATC 3 cut(s) 17, 190, 308
LmnI GCTCC 2 cut(s) 375, 401
LpnPI CCDG 5 cut(s) 107, 296, 325, 337, 358
Lsp1109I GCAGC 2 cut(s) 145, 157
MaeI CTAG 2 cut(s) 80, 167
MaeIII GTNAC 2 cut(s) 128, 296
MalI GATC 3 cut(s) 19, 192, 310
MboI GATC 3 cut(s) 17, 190, 308
MboII GAAGA 3 cut(s) 27, 102, 105
MflI RGATCY 3 cut(s) 17, 190, 308
MhlI GDGCHC 2 cut(s) 70, 372
MluCI AATT 1 cut(s) 422
MmeI TCCRAC 1 cut(s) 286
MnlI CCTC 2 cut(s) 126, 341
MseI TTAA 4 cut(s) 107, 233, 252, 460
MspCI CTTAAG 1 cut(s) 251
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeII GATC 3 cut(s) 17, 190, 308
NlaIII CATG 2 cut(s) 292, 404
NlaIV GGNNCC 4 cut(s) 206, 310, 377, 397
NmeAIII GCCGAG 1 cut(s) 97
NmuCI GTSAC 2 cut(s) 128, 296
PfeI GAWTC 1 cut(s) 96
PkrI GCNGC 2 cut(s) 160, 172
PshBI ATTAAT 1 cut(s) 107
PspEI GGTNACC 1 cut(s) 296
PspN4I GGNNCC 4 cut(s) 206, 310, 377, 397
PspPI GGNCC 1 cut(s) 204
PsuI RGATCY 3 cut(s) 17, 190, 308
RsaI GTAC 1 cut(s) 150
RsaNI GTAC 1 cut(s) 149
SaqAI TTAA 4 cut(s) 107, 233, 252, 460
SatI GCNGC 2 cut(s) 159, 171
Sau3AI GATC 3 cut(s) 17, 190, 308
Sau96I GGNCC 1 cut(s) 204
SduI GDGCHC 2 cut(s) 70, 372
SmlI CTYRAG 1 cut(s) 251
SmoI CTYRAG 1 cut(s) 251
Sse9I AATT 1 cut(s) 422
SspMI CTAG 2 cut(s) 80, 167
TaqI TCGA 3 cut(s) 34, 70, 187
TaqII GACCGA 1 cut(s) 315
TasI AATT 1 cut(s) 422
TatI WGTACW 1 cut(s) 148
TfiI GAWTC 1 cut(s) 96
Tru1I TTAA 4 cut(s) 107, 233, 252, 460
Tru9I TTAA 4 cut(s) 107, 233, 252, 460
TseFI GTSAC 2 cut(s) 128, 296
TseI GCWGC 2 cut(s) 158, 170
Tsp45I GTSAC 2 cut(s) 128, 296
Vha464I CTTAAG 1 cut(s) 251
VspI ATTAAT 1 cut(s) 107
XspI CTAG 2 cut(s) 80, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.