Rh4CG007800

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
N/A
Physical Location & Seq
Forward (+)
1435276 .. 1436443
1168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG007800.1

Sequence Viewer

Length: 249 bp
ATGGTTGATGCATTTGGGTACATACCAGAGTTTGTTTTGCACGATCAATTCAATGATGAGATTGATAATTACAATTTTGGAATACTTGCATTAAAGCTGATATCTAGAAAGAGGCTTACAGATTTTTCAATAGGTGAAGGCCTTTGGTATATGTTTGAGCCTATAATCAATTACTACTTTGATAAAAATTCAGCCATGGTAACTGAGGACGAGAGGACACATGATGACAATTTTCCTTTAACCTCTTGA

Protein Analysis

82

Amino Acids

9.71

Weight (kDa)

4.28

Isoelectric Point (pI)

28.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 187
AfaI GTAC 1 cut(s) 20
AgsI TTSAA 2 cut(s) 52, 129
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
AoxI GGCC 1 cut(s) 139
ApoI RAATTY 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 146
BfaI CTAG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 195
BseMII CTCAG 1 cut(s) 195
BshFI GGCC 1 cut(s) 141
BsnI GGCC 1 cut(s) 141
Bsp143I GATC 1 cut(s) 43
Bsp19I CCATGG 1 cut(s) 195
BspANI GGCC 1 cut(s) 141
BspCNI CTCAG 1 cut(s) 196
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 1 cut(s) 43
BssT1I CCWWGG 1 cut(s) 195
BstDEI CTNAG 1 cut(s) 204
BstDSI CCRYGG 1 cut(s) 195
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BsuRI GGCC 1 cut(s) 141
BtgI CCRYGG 1 cut(s) 195
Csp6I GTAC 1 cut(s) 19
CviAII CATG 2 cut(s) 196, 221
CviJI RGCY 5 cut(s) 97, 115, 141, 160, 194
CviKI_1 RGCY 5 cut(s) 97, 115, 141, 160, 194
CviQI GTAC 1 cut(s) 19
DdeI CTNAG 1 cut(s) 204
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 195
Eco147I AGGCCT 1 cut(s) 141
Eco32I GATATC 1 cut(s) 102
EcoRV GATATC 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 195
EcoT22I ATGCAT 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 195
FaeI CATG 2 cut(s) 199, 224
FaiI YATR 6 cut(s) 23, 150, 152, 164, 197, 222
FatI CATG 2 cut(s) 195, 220
FspBI CTAG 1 cut(s) 105
HaeIII GGCC 1 cut(s) 141
Hin1II CATG 2 cut(s) 199, 224
HphI GGTGA 1 cut(s) 146
Hpy188III TCNNGA 2 cut(s) 105, 246
HpyAV CCTTC 1 cut(s) 131
HpyCH4V TGCA 3 cut(s) 11, 40, 89
HpyF3I CTNAG 1 cut(s) 204
Hsp92II CATG 2 cut(s) 199, 224
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 1 cut(s) 39
MaeI CTAG 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 199
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MluCI AATT 6 cut(s) 47, 67, 73, 169, 187, 229
MnlI CCTC 3 cut(s) 105, 199, 207
Mph1103I ATGCAT 1 cut(s) 13
MseI TTAA 2 cut(s) 92, 239
NcoI CCATGG 1 cut(s) 195
NdeII GATC 1 cut(s) 43
NlaIII CATG 2 cut(s) 199, 224
NsiI ATGCAT 1 cut(s) 13
PceI AGGCCT 1 cut(s) 141
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SaqAI TTAA 2 cut(s) 92, 239
Sau3AI GATC 1 cut(s) 43
SetI ASST 3 cut(s) 99, 136, 245
SgeI CNNG 7 cut(s) 38, 53, 98, 117, 208, 223, 233
Sse9I AATT 6 cut(s) 47, 67, 73, 169, 187, 229
SseBI AGGCCT 1 cut(s) 141
SspMI CTAG 1 cut(s) 105
StuI AGGCCT 1 cut(s) 141
StyI CCWWGG 1 cut(s) 195
TasI AATT 6 cut(s) 47, 67, 73, 169, 187, 229
Tru1I TTAA 2 cut(s) 92, 239
Tru9I TTAA 2 cut(s) 92, 239
XapI RAATTY 1 cut(s) 187
XbaI TCTAGA 1 cut(s) 104
XspI CTAG 1 cut(s) 105
Zsp2I ATGCAT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.