Rh4CG150300

Calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
N/A
Physical Location & Seq
Reverse (-)
33169096 .. 33169771
676 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG150300.1

Sequence Viewer

Length: 390 bp
ATGCAGGTCATCTTTTTGTCCTTTCTTGGTAGAGGCATCTACTCCTTGCTTGGCATCCGGCGGTTGTTGTTCCATAGCAATGGTGTTTCCATTTGTCTTAAATTCTCCTCCCCTGTTTCCTCAATGCCAAGCTTTGCATTCTTCAACCCTAGTTCTATGATTGTGAAATTTAGTTGTACATTGGAGTTCTCAGCCAGCATAGATGCAGTTCATCGAGAGATGAGCTCAGGCAAGTTGCTCTTATTGTTGGATTCCCTTTCATTTAGGCTTGAAGCTAAAGAAATGATTAACAGATCTAGACTAGCAGAAGTTAAAGGAGCACAACCAGATTTAGGATATCGCATCCACAGCAAAAGGAAACTGCACAATTGGACTTGGTGGGAAGAGTAA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.75

Weight (kDa)

9.75

Isoelectric Point (pI)

42.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 61
AcsI RAATTY 2 cut(s) 101, 167
AfaI GTAC 1 cut(s) 178
AfiI CCNNNNNNNGG 1 cut(s) 332
AgsI TTSAA 2 cut(s) 145, 272
AluBI AGCT 3 cut(s) 132, 225, 275
AluI AGCT 3 cut(s) 132, 225, 275
Alw21I GWGCWC 2 cut(s) 227, 322
ApoI RAATTY 2 cut(s) 101, 167
BanII GRGCYC 1 cut(s) 227
Bbv12I GWGCWC 2 cut(s) 227, 322
BfaI CTAG 3 cut(s) 150, 297, 302
BglII AGATCT 1 cut(s) 293
BmsI GCATC 4 cut(s) 45, 63, 193, 351
BplI GAGNNNNNCTC 2 cut(s) 209, 241
Bpu10I CCTNAGC 1 cut(s) 226
Bsc4I CCNNNNNNNGG 1 cut(s) 332
Bse3DI GCAATG 1 cut(s) 85
BseGI GGATG 2 cut(s) 54, 342
BseLI CCNNNNNNNGG 1 cut(s) 332
BseMI GCAATG 1 cut(s) 85
BseMII CTCAG 2 cut(s) 204, 240
BseRI GAGGAG 1 cut(s) 97
BsgI GTGCAG 1 cut(s) 347
BsiHKAI GWGCWC 2 cut(s) 227, 322
BsiSI CCGG 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 332
BsmI GAATGC 1 cut(s) 137
Bsp1286I GDGCHC 2 cut(s) 227, 322
Bsp1407I TGTACA 1 cut(s) 176
Bsp143I GATC 1 cut(s) 293
BspACI CCGC 1 cut(s) 61
BspCNI CTCAG 2 cut(s) 203, 239
BsrDI GCAATG 1 cut(s) 85
BsrGI TGTACA 1 cut(s) 176
BssMI GATC 1 cut(s) 293
Bst6I CTCTTC 1 cut(s) 378
BstAUI TGTACA 1 cut(s) 176
BstC8I GCNNGC 1 cut(s) 196
BstDEI CTNAG 2 cut(s) 190, 226
BstF5I GGATG 2 cut(s) 54, 342
BstKTI GATC 1 cut(s) 296
BstMBI GATC 1 cut(s) 293
BstMWI GCNNNNNNNGC 1 cut(s) 348
BstX2I RGATCY 1 cut(s) 293
BstXI CCANNNNNNTGG 1 cut(s) 80
BstYI RGATCY 1 cut(s) 293
BtsCI GGATG 2 cut(s) 54, 342
Cac8I GCNNGC 1 cut(s) 196
Csp6I GTAC 1 cut(s) 177
CviJI RGCY 5 cut(s) 132, 194, 225, 268, 275
CviKI_1 RGCY 5 cut(s) 132, 194, 225, 268, 275
CviQI GTAC 1 cut(s) 177
DdeI CTNAG 2 cut(s) 190, 226
DpnI GATC 1 cut(s) 295
DpnII GATC 1 cut(s) 293
Eam1104I CTCTTC 1 cut(s) 378
EarI CTCTTC 1 cut(s) 378
Ecl136II GAGCTC 1 cut(s) 225
Eco24I GRGCYC 1 cut(s) 227
Eco32I GATATC 1 cut(s) 338
Eco53kI GAGCTC 1 cut(s) 225
EcoICRI GAGCTC 1 cut(s) 225
EcoRV GATATC 1 cut(s) 338
EcoT38I GRGCYC 1 cut(s) 227
FaiI YATR 3 cut(s) 75, 158, 200
FalI AAGNNNNNCTT 2 cut(s) 224, 256
FokI GGATG 2 cut(s) 41, 329
FriOI GRGCYC 1 cut(s) 227
FspBI CTAG 3 cut(s) 150, 297, 302
HapII CCGG 1 cut(s) 58
HindIII AAGCTT 1 cut(s) 130
HinfI GANTC 1 cut(s) 251
HpaII CCGG 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 215, 297
HpyCH4V TGCA 4 cut(s) 4, 137, 206, 364
HpyF10VI GCNNNNNNNGC 1 cut(s) 348
HpyF3I CTNAG 2 cut(s) 190, 226
Kzo9I GATC 1 cut(s) 293
LmnI GCTCC 1 cut(s) 317
LpnPI CCDG 5 cut(s) 71, 126, 208, 213, 339
LweI GCATC 4 cut(s) 45, 63, 193, 351
MaeI CTAG 3 cut(s) 150, 297, 302
MalI GATC 1 cut(s) 295
MboI GATC 1 cut(s) 293
MboII GAAGA 1 cut(s) 133
MfeI CAATTG 1 cut(s) 367
MflI RGATCY 1 cut(s) 293
MhlI GDGCHC 2 cut(s) 227, 322
MluCI AATT 3 cut(s) 101, 167, 367
MmeI TCCRAC 1 cut(s) 228
MnlI CCTC 3 cut(s) 26, 118, 130
MseI TTAA 3 cut(s) 99, 288, 312
MslI CAYNNNNRTG 1 cut(s) 78
MspI CCGG 1 cut(s) 58
MunI CAATTG 1 cut(s) 367
Mva1269I GAATGC 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 348
NdeII GATC 1 cut(s) 293
PctI GAATGC 1 cut(s) 137
PfeI GAWTC 1 cut(s) 251
Psp124BI GAGCTC 1 cut(s) 227
PsuI RGATCY 1 cut(s) 293
RsaI GTAC 1 cut(s) 178
RsaNI GTAC 1 cut(s) 177
RseI CAYNNNNRTG 1 cut(s) 78
SacI GAGCTC 1 cut(s) 227
SaqAI TTAA 3 cut(s) 99, 288, 312
Sau3AI GATC 1 cut(s) 293
SduI GDGCHC 2 cut(s) 227, 322
SetI ASST 4 cut(s) 9, 134, 227, 277
SfaNI GCATC 4 cut(s) 45, 63, 193, 351
SmiMI CAYNNNNRTG 1 cut(s) 78
Sse9I AATT 3 cut(s) 101, 167, 367
SsiI CCGC 1 cut(s) 61
SspMI CTAG 3 cut(s) 150, 297, 302
SstI GAGCTC 1 cut(s) 227
TaqI TCGA 1 cut(s) 214
TasI AATT 3 cut(s) 101, 167, 367
TatI WGTACW 1 cut(s) 176
TfiI GAWTC 1 cut(s) 251
Tru1I TTAA 3 cut(s) 99, 288, 312
Tru9I TTAA 3 cut(s) 99, 288, 312
TspDTI ATGAA 2 cut(s) 200, 249
XapI RAATTY 2 cut(s) 101, 167
XbaI TCTAGA 1 cut(s) 296
XspI CTAG 3 cut(s) 150, 297, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.