Rh5AG099000

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
N/A
Physical Location & Seq
Forward (+)
9165005 .. 9165539
535 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG099000.1

Sequence Viewer

Length: 420 bp
ATGCTCAAACTAATGTTTCTTGAATTTGATAATTTAATAATTAATTCAGGCCCCAAATTCCTCCCAAGTTCCTTGAGAATTCTCAAATGGAATCGGTATCCTTCCAAATACCTTCCAGCAAGTTTCCAGCCAAATTTACTTGTTGAACTTAAGATGAAAAGAAGCAAACTGTCCGGCTTTGGGATGGAAAACAGTGACTCCAAAAACTTGAGGAAGACCCCAGATTTCAGAGGTATTCCGAATCTTGAGGAGTTGAATCTTGAATATTGTGACGGTTTATTTGAGATCCATCCATCCATTTCAGTCAACAAAAAGCTTAGAAAGTTGACAGTTGATCAATGTAAAAATATTAAGAGCTTCCCAAGTAAAATAGAAATGGATTCTCTCGAGTTTTTCAACCTTCGCGGTTGCTCAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

16.14

Weight (kDa)

9.43

Isoelectric Point (pI)

47.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 405
AciI CCGC 1 cut(s) 405
AclWI GGATC 1 cut(s) 280
AcsI RAATTY 4 cut(s) 23, 56, 78, 133
AfiI CCNNNNNNNGG 1 cut(s) 180
AflII CTTAAG 1 cut(s) 149
AgsI TTSAA 5 cut(s) 23, 146, 256, 263, 397
AluBI AGCT 2 cut(s) 316, 357
AluI AGCT 2 cut(s) 316, 357
AlwI GGATC 1 cut(s) 280
Ama87I CYCGRG 1 cut(s) 386
AoxI GGCC 1 cut(s) 49
ApoI RAATTY 4 cut(s) 23, 56, 78, 133
ArsI GACNNNNNNTTYG 2 cut(s) 263, 295
AseI ATTAAT 1 cut(s) 42
AspS9I GGNCC 1 cut(s) 50
AvaI CYCGRG 1 cut(s) 386
BbsI GAAGAC 1 cut(s) 221
BccI CCATC 3 cut(s) 178, 297, 301
BciVI GTATCC 1 cut(s) 108
BclI TGATCA 1 cut(s) 334
BfrI CTTAAG 1 cut(s) 149
BfuI GTATCC 1 cut(s) 108
BmeT110I CYCGRG 1 cut(s) 386
BmgT120I GGNCC 1 cut(s) 50
BmiI GGNNCC 1 cut(s) 52
BpiI GAAGAC 1 cut(s) 221
BpuEI CTTGAG 3 cut(s) 94, 229, 266
BsaXI ACNNNNNCTCC 2 cut(s) 182, 212
Bsc4I CCNNNNNNNGG 1 cut(s) 180
BseGI GGATG 3 cut(s) 189, 289, 293
BseLI CCNNNNNNNGG 1 cut(s) 180
BseRI GAGGAG 1 cut(s) 263
Bsh1236I CGCG 1 cut(s) 405
BshFI GGCC 1 cut(s) 51
BsiHKCI CYCGRG 1 cut(s) 386
BsiSI CCGG 1 cut(s) 174
BslI CCNNNNNNNGG 1 cut(s) 180
BsnI GGCC 1 cut(s) 51
BsoBI CYCGRG 1 cut(s) 386
Bsp143I GATC 2 cut(s) 285, 334
BspACI CCGC 1 cut(s) 405
BspANI GGCC 1 cut(s) 51
BspFNI CGCG 1 cut(s) 405
BspLI GGNNCC 1 cut(s) 52
BspPI GGATC 1 cut(s) 280
BspTI CTTAAG 1 cut(s) 149
BssMI GATC 2 cut(s) 285, 334
Bst4CI ACNGT 4 cut(s) 171, 194, 275, 331
BstAFI CTTAAG 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 317
BstF5I GGATG 3 cut(s) 189, 289, 293
BstFNI CGCG 1 cut(s) 405
BstKTI GATC 2 cut(s) 288, 337
BstMBI GATC 2 cut(s) 285, 334
BstUI CGCG 1 cut(s) 405
BstV2I GAAGAC 1 cut(s) 221
BstX2I RGATCY 1 cut(s) 285
BstYI RGATCY 1 cut(s) 285
BsuI GTATCC 1 cut(s) 108
BsuRI GGCC 1 cut(s) 51
BtsCI GGATG 3 cut(s) 189, 289, 293
BtsIMutI CAGTG 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 50
CviJI RGCY 5 cut(s) 51, 130, 177, 316, 357
CviKI_1 RGCY 5 cut(s) 51, 130, 177, 316, 357
DdeI CTNAG 1 cut(s) 317
DpnI GATC 2 cut(s) 287, 336
DpnII GATC 2 cut(s) 285, 334
Eco88I CYCGRG 1 cut(s) 386
EcoO109I RGGNCCY 1 cut(s) 50
EcoRI GAATTC 1 cut(s) 78
FbaI TGATCA 1 cut(s) 334
FokI GGATG 3 cut(s) 196, 276, 280
HaeIII GGCC 1 cut(s) 51
HapII CCGG 1 cut(s) 174
HincII GTYRAC 2 cut(s) 307, 327
HindII GTYRAC 2 cut(s) 307, 327
HindIII AAGCTT 1 cut(s) 314
HinfI GANTC 5 cut(s) 91, 197, 241, 256, 380
HpaII CCGG 1 cut(s) 174
Hpy166II GTNNAC 2 cut(s) 307, 327
Hpy188I TCNGA 2 cut(s) 230, 240
Hpy188III TCNNGA 4 cut(s) 20, 245, 260, 386
Hpy8I GTNNAC 2 cut(s) 307, 327
HpyAV CCTTC 3 cut(s) 111, 122, 410
HpyCH4III ACNGT 4 cut(s) 171, 194, 275, 331
HpyF3I CTNAG 1 cut(s) 317
Ksp22I TGATCA 1 cut(s) 334
Kzo9I GATC 2 cut(s) 285, 334
LpnPI CCDG 5 cut(s) 33, 129, 140, 187, 234
MaeIII GTNAC 2 cut(s) 194, 269
MalI GATC 2 cut(s) 287, 336
MboI GATC 2 cut(s) 285, 334
MboII GAAGA 1 cut(s) 226
MflI RGATCY 1 cut(s) 285
MluCI AATT 8 cut(s) 23, 31, 39, 43, 56, 78, 133, 415
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 4 cut(s) 71, 204, 224, 241
MseI TTAA 5 cut(s) 35, 42, 150, 351, 418
MspCI CTTAAG 1 cut(s) 149
MspI CCGG 1 cut(s) 174
MvnI CGCG 1 cut(s) 405
NdeII GATC 2 cut(s) 285, 334
NlaIV GGNNCC 1 cut(s) 52
NmuCI GTSAC 2 cut(s) 194, 269
PaeR7I CTCGAG 1 cut(s) 386
PfeI GAWTC 4 cut(s) 91, 241, 256, 380
PleI GAGTC 1 cut(s) 191
PpsI GAGTC 1 cut(s) 191
PshBI ATTAAT 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 52
PspPI GGNCC 1 cut(s) 50
PsuI RGATCY 1 cut(s) 285
SaqAI TTAA 5 cut(s) 35, 42, 150, 351, 418
Sau3AI GATC 2 cut(s) 285, 334
Sau96I GGNCC 1 cut(s) 50
SchI GAGTC 1 cut(s) 191
SetI ASST 5 cut(s) 114, 235, 318, 359, 402
Sfr274I CTCGAG 1 cut(s) 386
SlaI CTCGAG 1 cut(s) 386
SmlI CTYRAG 5 cut(s) 73, 149, 208, 245, 386
SmoI CTYRAG 5 cut(s) 73, 149, 208, 245, 386
Sse9I AATT 8 cut(s) 23, 31, 39, 43, 56, 78, 133, 415
SsiI CCGC 1 cut(s) 405
SspI AATATT 2 cut(s) 266, 349
TaaI ACNGT 4 cut(s) 171, 194, 275, 331
TaqI TCGA 1 cut(s) 387
TasI AATT 8 cut(s) 23, 31, 39, 43, 56, 78, 133, 415
TfiI GAWTC 4 cut(s) 91, 241, 256, 380
Tru1I TTAA 5 cut(s) 35, 42, 150, 351, 418
Tru9I TTAA 5 cut(s) 35, 42, 150, 351, 418
TscAI CASTG 1 cut(s) 199
TseFI GTSAC 2 cut(s) 194, 269
Tsp45I GTSAC 2 cut(s) 194, 269
TspDTI ATGAA 1 cut(s) 170
TspRI CASTG 1 cut(s) 199
Vha464I CTTAAG 1 cut(s) 149
VspI ATTAAT 1 cut(s) 42
XapI RAATTY 4 cut(s) 23, 56, 78, 133
XhoI CTCGAG 1 cut(s) 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.