Rh5AG107400
NBS-LRR Family

Disease resistance protein (TIR-NBS-LRR class)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
N/A
Physical Location & Seq
Forward (+)
9842000 .. 9842943
944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG107400.1

Sequence Viewer

Length: 348 bp
ATGGTGATAGCCATCAATTCAACCATTTTTTTTTCAATTCAAGTTCACTCATTGTTGACCAGCTTGGGTGATGTCAATTCAGATCACATATTCGTGTGGTATGATAGCCTTGAAAAGGTGAGGTCCACTCAATTATGCAATGCCACCATTGAAGCCTCTTTCAACTTCTATGCGCAAAATTATGTGACAACGAGGTGTGGGGTTTGTTTCTTGTATGCTCAAGCACTCGATCAAGATGCTGTCAAGTGCCAAATCATTGATCAAGTCCCAACTAAGGCCAGTCCCGATGATGAGTTTGTAGCTAGTGAAAGTGAGATTTCAGTAAGCTCTCTTGAAATGATGTTTTGA

Protein Analysis

115

Amino Acids

12.86

Weight (kDa)

4.24

Isoelectric Point (pI)

41.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 174
AfiI CCNNNNNNNGG 2 cut(s) 115, 274
AgsI TTSAA 7 cut(s) 21, 36, 41, 113, 152, 163, 335
AluBI AGCT 3 cut(s) 63, 302, 327
AluI AGCT 3 cut(s) 63, 302, 327
AoxI GGCC 1 cut(s) 276
AspLEI GCGC 1 cut(s) 175
AspS9I GGNCC 1 cut(s) 123
AsuHPI GGTGA 3 cut(s) 16, 80, 130
AvaII GGWCC 1 cut(s) 123
BccI CCATC 1 cut(s) 20
BcgI CGANNNNNNTGC 2 cut(s) 218, 252
BclI TGATCA 1 cut(s) 259
BfaI CTAG 1 cut(s) 303
Bme18I GGWCC 1 cut(s) 123
BmgT120I GGNCC 1 cut(s) 123
BmsI GCATC 1 cut(s) 226
BplI GAGNNNNNCTC 2 cut(s) 112, 144
BpuEI CTTGAG 1 cut(s) 204
BsaBI GATNNNNATC 1 cut(s) 11
Bsc4I CCNNNNNNNGG 2 cut(s) 115, 274
Bse1I ACTGG 1 cut(s) 279
Bse3DI GCAATG 1 cut(s) 145
Bse8I GATNNNNATC 1 cut(s) 11
BseJI GATNNNNATC 1 cut(s) 11
BseLI CCNNNNNNNGG 2 cut(s) 115, 274
BseMI GCAATG 1 cut(s) 145
BseNI ACTGG 1 cut(s) 279
BshFI GGCC 1 cut(s) 278
BslFI GGGAC 2 cut(s) 251, 267
BslI CCNNNNNNNGG 2 cut(s) 115, 274
BsmFI GGGAC 2 cut(s) 251, 267
BsnI GGCC 1 cut(s) 278
Bsp143I GATC 3 cut(s) 82, 229, 259
BspANI GGCC 1 cut(s) 278
BsrDI GCAATG 1 cut(s) 145
BsrI ACTGG 1 cut(s) 279
BssMI GATC 3 cut(s) 82, 229, 259
BstDEI CTNAG 1 cut(s) 273
BstENI CCTNNNNNAGG 1 cut(s) 113
BstHHI GCGC 1 cut(s) 175
BstKTI GATC 3 cut(s) 85, 232, 262
BstMBI GATC 3 cut(s) 82, 229, 259
BsuRI GGCC 1 cut(s) 278
CfoI GCGC 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 123
CviJI RGCY 7 cut(s) 11, 63, 108, 155, 278, 302, 327
CviKI_1 RGCY 7 cut(s) 11, 63, 108, 155, 278, 302, 327
DdeI CTNAG 1 cut(s) 273
DpnI GATC 3 cut(s) 84, 231, 261
DpnII GATC 3 cut(s) 82, 229, 259
Eco47I GGWCC 1 cut(s) 123
EcoNI CCTNNNNNAGG 1 cut(s) 113
FaiI YATR 6 cut(s) 89, 102, 136, 171, 183, 216
FaqI GGGAC 2 cut(s) 251, 267
FbaI TGATCA 1 cut(s) 259
FspBI CTAG 1 cut(s) 303
FspI TGCGCA 1 cut(s) 174
GlaI GCGC 1 cut(s) 174
HaeIII GGCC 1 cut(s) 278
HhaI GCGC 1 cut(s) 175
Hin6I GCGC 1 cut(s) 173
HinP1I GCGC 1 cut(s) 173
HincII GTYRAC 1 cut(s) 57
HindII GTYRAC 1 cut(s) 57
HphI GGTGA 3 cut(s) 16, 80, 130
Hpy166II GTNNAC 3 cut(s) 46, 57, 126
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 3 cut(s) 233, 284, 332
Hpy8I GTNNAC 3 cut(s) 46, 57, 126
HpyCH4V TGCA 1 cut(s) 138
HpyF3I CTNAG 1 cut(s) 273
HspAI GCGC 1 cut(s) 173
Ksp22I TGATCA 1 cut(s) 259
Kzo9I GATC 3 cut(s) 82, 229, 259
LpnPI CCDG 2 cut(s) 73, 292
LweI GCATC 1 cut(s) 226
MaeI CTAG 1 cut(s) 303
MaeIII GTNAC 1 cut(s) 184
MalI GATC 3 cut(s) 84, 231, 261
MboI GATC 3 cut(s) 82, 229, 259
MluCI AATT 5 cut(s) 16, 36, 76, 131, 178
MnlI CCTC 3 cut(s) 114, 166, 186
MslI CAYNNNNRTG 1 cut(s) 92
NdeII GATC 3 cut(s) 82, 229, 259
NmuCI GTSAC 1 cut(s) 184
NsbI TGCGCA 1 cut(s) 174
PspPI GGNCC 1 cut(s) 123
RseI CAYNNNNRTG 1 cut(s) 92
Sau3AI GATC 3 cut(s) 82, 229, 259
Sau96I GGNCC 1 cut(s) 123
SetI ASST 6 cut(s) 65, 120, 125, 197, 304, 329
SfaNI GCATC 1 cut(s) 226
SinI GGWCC 1 cut(s) 123
SmiMI CAYNNNNRTG 1 cut(s) 92
SmlI CTYRAG 1 cut(s) 219
SmoI CTYRAG 1 cut(s) 219
Sse9I AATT 5 cut(s) 16, 36, 76, 131, 178
SspMI CTAG 1 cut(s) 303
TaqI TCGA 1 cut(s) 228
TasI AATT 5 cut(s) 16, 36, 76, 131, 178
TseFI GTSAC 1 cut(s) 184
Tsp45I GTSAC 1 cut(s) 184
VpaK11BI GGWCC 1 cut(s) 123
XagI CCTNNNNNAGG 1 cut(s) 113
XspI CTAG 1 cut(s) 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.