Rh5BG297000
TCP Family

Belongs to the chaperonin (HSP60) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
N/A
Physical Location & Seq
Reverse (-)
37994718 .. 38010264
15547 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG297000.1

Sequence Viewer

Length: 321 bp
ATGTGTAGTGTTGGTGAAGATAGTAGTTGGGTGGATATATGGTGCTTTTTCATTAATTCTCAGGCAAAATCATGCCATTCTGATAAAGCTTCGTGCTGGAATCAAGCATTTTCTAAGCTAATGGGTGTTGCTACAAGTGGCACTGTTATTACTGAAGAGCTGGGTTTGAACCTCGAGAAAGTGGATCTGGATATGCTTGGAACTTGCAAAAAGGTCACAATTTCAAAAGATGACACTGTAATTCTTGACGGTGCTGGTGACAAGAAGGAAATTGAGGAAAGATGTGAACAGATTTGTCTCGTTGTGAATTATAAAAGCTAA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.69

Weight (kDa)

4.64

Isoelectric Point (pI)

34.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 312
AclWI GGATC 1 cut(s) 192
AcuI CTGAAG 1 cut(s) 174
AgsI TTSAA 2 cut(s) 169, 225
AluBI AGCT 4 cut(s) 89, 118, 160, 318
AluI AGCT 4 cut(s) 89, 118, 160, 318
Alw26I GTCTC 1 cut(s) 302
AlwI GGATC 1 cut(s) 192
Ama87I CYCGRG 1 cut(s) 173
AseI ATTAAT 1 cut(s) 54
AsuHPI GGTGA 2 cut(s) 26, 269
AvaI CYCGRG 1 cut(s) 173
BcoDI GTCTC 1 cut(s) 302
BmeT110I CYCGRG 1 cut(s) 173
BseMII CTCAG 1 cut(s) 74
BseYI CCCAGC 1 cut(s) 160
BsiHKCI CYCGRG 1 cut(s) 173
BsmAI GTCTC 1 cut(s) 302
BsoBI CYCGRG 1 cut(s) 173
Bsp143I GATC 1 cut(s) 184
BspCNI CTCAG 1 cut(s) 73
BspPI GGATC 1 cut(s) 192
BspQI GCTCTTC 1 cut(s) 150
BssMI GATC 1 cut(s) 184
Bst4CI ACNGT 3 cut(s) 145, 238, 251
Bst6I CTCTTC 1 cut(s) 150
BstDEI CTNAG 2 cut(s) 60, 114
BstKTI GATC 1 cut(s) 187
BstMAI GTCTC 1 cut(s) 302
BstMBI GATC 1 cut(s) 184
BstX2I RGATCY 1 cut(s) 184
BstYI RGATCY 1 cut(s) 184
BtsIMutI CAGTG 2 cut(s) 141, 234
CviAII CATG 1 cut(s) 72
CviJI RGCY 4 cut(s) 89, 118, 160, 318
CviKI_1 RGCY 4 cut(s) 89, 118, 160, 318
DdeI CTNAG 2 cut(s) 60, 114
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco57I CTGAAG 1 cut(s) 174
Eco88I CYCGRG 1 cut(s) 173
FaeI CATG 1 cut(s) 75
FaiI YATR 5 cut(s) 38, 40, 73, 194, 312
FatI CATG 1 cut(s) 71
GsaI CCCAGC 1 cut(s) 164
Hin1II CATG 1 cut(s) 75
HindIII AAGCTT 1 cut(s) 87
HinfI GANTC 1 cut(s) 100
HphI GGTGA 2 cut(s) 26, 269
Hpy166II GTNNAC 1 cut(s) 287
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 3 cut(s) 175, 188, 245
Hpy8I GTNNAC 1 cut(s) 287
HpyAV CCTTC 1 cut(s) 259
HpyCH4III ACNGT 3 cut(s) 145, 238, 251
HpyCH4V TGCA 1 cut(s) 207
HpyF3I CTNAG 2 cut(s) 60, 114
Hsp92II CATG 1 cut(s) 75
Kzo9I GATC 1 cut(s) 184
LguI GCTCTTC 1 cut(s) 150
LpnPI CCDG 5 cut(s) 47, 82, 146, 173, 240
MaeIII GTNAC 2 cut(s) 214, 257
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 2 cut(s) 29, 167
MflI RGATCY 1 cut(s) 184
MluCI AATT 5 cut(s) 55, 219, 240, 270, 307
MnlI CCTC 2 cut(s) 182, 268
MseI TTAA 1 cut(s) 54
NdeII GATC 1 cut(s) 184
NlaIII CATG 1 cut(s) 75
NmuCI GTSAC 2 cut(s) 214, 257
PaeR7I CTCGAG 1 cut(s) 173
PciSI GCTCTTC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 100
PshBI ATTAAT 1 cut(s) 54
PsiI TTATAA 1 cut(s) 312
PspFI CCCAGC 1 cut(s) 160
PsuI RGATCY 1 cut(s) 184
SapI GCTCTTC 1 cut(s) 150
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 1 cut(s) 184
SetI ASST 6 cut(s) 91, 120, 162, 174, 216, 320
Sfr274I CTCGAG 1 cut(s) 173
SlaI CTCGAG 1 cut(s) 173
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 5 cut(s) 55, 219, 240, 270, 307
TaaI ACNGT 3 cut(s) 145, 238, 251
TaqI TCGA 1 cut(s) 174
TasI AATT 5 cut(s) 55, 219, 240, 270, 307
TfiI GAWTC 1 cut(s) 100
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 2 cut(s) 148, 241
TseFI GTSAC 2 cut(s) 214, 257
Tsp45I GTSAC 2 cut(s) 214, 257
TspDTI ATGAA 1 cut(s) 40
TspRI CASTG 2 cut(s) 148, 241
VspI ATTAAT 1 cut(s) 54
XhoI CTCGAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.