Rh5DG210200

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
N/A
Physical Location & Seq
Reverse (-)
23285192 .. 23293184
7993 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG210200.1

Sequence Viewer

Length: 255 bp
ATGGCAGATTTTATACCCCCGAAAAAACCCTCGCTAGGAAGTGGTATATCGGCAGGTGAAGTCGTTGGAATTGTGGCTGGAGGAGTGTCCATAATATTAGTGATTTTATGTATTCTCTGGTGGAAAGGCTTCATAGGACCACCAAATACTTTGGAACAAGATAACAAAAATAACCCACATAGCAAATCTACCCCCAGTTCAAATTCTCAACTTCTCAACCACAAGCAGGTTCCAAATGATTCAAAAGCTCACTAA

Protein Analysis

84

Amino Acids

8.9

Weight (kDa)

8.93

Isoelectric Point (pI)

41.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 44
Acc36I ACCTGC 2 cut(s) 44, 217
AcsI RAATTY 1 cut(s) 202
AfiI CCNNNNNNNGG 2 cut(s) 35, 226
AgsI TTSAA 2 cut(s) 201, 243
AluBI AGCT 1 cut(s) 248
AluI AGCT 1 cut(s) 248
ApoI RAATTY 1 cut(s) 202
Asp700I GAANNNNTTC 1 cut(s) 128
AspS9I GGNCC 1 cut(s) 137
AsuHPI GGTGA 1 cut(s) 68
AvaII GGWCC 1 cut(s) 137
BfaI CTAG 1 cut(s) 35
BfuAI ACCTGC 2 cut(s) 44, 217
Bme18I GGWCC 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 137
BmiI GGNNCC 1 cut(s) 231
BmrI ACTGGG 1 cut(s) 189
BmuI ACTGGG 1 cut(s) 189
BpmI CTGGAG 1 cut(s) 99
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 226
Bse1I ACTGG 1 cut(s) 195
BseLI CCNNNNNNNGG 2 cut(s) 35, 226
BseNI ACTGG 1 cut(s) 195
BseRI GAGGAG 1 cut(s) 96
BslI CCNNNNNNNGG 2 cut(s) 35, 226
BspLI GGNNCC 1 cut(s) 231
BspMI ACCTGC 2 cut(s) 44, 217
BsrI ACTGG 1 cut(s) 195
BveI ACCTGC 2 cut(s) 44, 217
Cfr13I GGNCC 1 cut(s) 137
CviJI RGCY 3 cut(s) 77, 129, 248
CviKI_1 RGCY 3 cut(s) 77, 129, 248
Eco47I GGWCC 1 cut(s) 137
FaiI YATR 6 cut(s) 14, 47, 92, 109, 134, 180
FspBI CTAG 1 cut(s) 35
GsuI CTGGAG 1 cut(s) 99
HinfI GANTC 1 cut(s) 239
HphI GGTGA 1 cut(s) 68
LpnPI CCDG 5 cut(s) 39, 63, 103, 208, 212
MaeI CTAG 1 cut(s) 35
MluCI AATT 2 cut(s) 69, 202
MmeI TCCRAC 1 cut(s) 46
MnlI CCTC 2 cut(s) 40, 74
MroXI GAANNNNTTC 1 cut(s) 128
NlaIV GGNNCC 1 cut(s) 231
PaqCI CACCTGC 1 cut(s) 44
PdmI GAANNNNTTC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 239
PspN4I GGNNCC 1 cut(s) 231
PspPI GGNCC 1 cut(s) 137
Sau96I GGNCC 1 cut(s) 137
SetI ASST 3 cut(s) 58, 231, 250
SinI GGWCC 1 cut(s) 137
Sse9I AATT 2 cut(s) 69, 202
SspI AATATT 1 cut(s) 96
SspMI CTAG 1 cut(s) 35
TasI AATT 2 cut(s) 69, 202
TfiI GAWTC 1 cut(s) 239
TspDTI ATGAA 1 cut(s) 121
VpaK11BI GGWCC 1 cut(s) 137
XapI RAATTY 1 cut(s) 202
XmnI GAANNNNTTC 1 cut(s) 128
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.