Rh6AG021300
HSP70 Family

Belongs to the heat shock protein 70 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
N/A
Physical Location & Seq
Forward (+)
2385018 .. 2385939
922 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG021300.1

Sequence Viewer

Length: 249 bp
ATGGGTGAGTTTGTGCTCAACAACATTTCCCCAGCTCCCAAGCATGTTTCTAAGTTTGATGTCTATGTTGAAGACAAGTCCACTAAAGGGATTACAATCAACACTGAGACAAGAACCATGAGGAATGGAAGATCCTTCTCGCATAAGCTTAAAACCATGGCAAATAGGTGGCGTGGTTATGTTATTAAGAAATTTGGTCTTCTTAGGATTGATATCTATAGGATTTCATTTAATCTGAGAACACTTTGA
Functional Annotation

Protein Analysis

82

Amino Acids

9.61

Weight (kDa)

10.58

Isoelectric Point (pI)

38.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 126
AcsI RAATTY 1 cut(s) 191
AfiI CCNNNNNNNGG 1 cut(s) 87
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 2 cut(s) 35, 148
AluI AGCT 2 cut(s) 35, 148
Alw21I GWGCWC 1 cut(s) 18
Alw26I GTCTC 1 cut(s) 101
AlwI GGATC 1 cut(s) 126
ApoI RAATTY 1 cut(s) 191
AsuHPI GGTGA 1 cut(s) 17
BbsI GAAGAC 2 cut(s) 78, 191
Bbv12I GWGCWC 1 cut(s) 18
BcoDI GTCTC 1 cut(s) 101
BfmI CTRYAG 1 cut(s) 217
BpiI GAAGAC 2 cut(s) 78, 191
BsaBI GATNNNNATC 2 cut(s) 95, 212
BsaJI CCNNGG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 87
Bse8I GATNNNNATC 2 cut(s) 95, 212
BseDI CCNNGG 1 cut(s) 156
BseJI GATNNNNATC 2 cut(s) 95, 212
BseLI CCNNNNNNNGG 1 cut(s) 87
BseMII CTCAG 2 cut(s) 96, 227
BseYI CCCAGC 1 cut(s) 31
BsiHKAI GWGCWC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 87
BsmAI GTCTC 1 cut(s) 101
Bsp1286I GDGCHC 1 cut(s) 18
Bsp143I GATC 1 cut(s) 131
Bsp19I CCATGG 1 cut(s) 156
BspCNI CTCAG 2 cut(s) 97, 228
BspPI GGATC 1 cut(s) 126
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 131
BssT1I CCWWGG 1 cut(s) 156
BstDEI CTNAG 4 cut(s) 51, 105, 203, 236
BstDSI CCRYGG 1 cut(s) 156
BstKTI GATC 1 cut(s) 134
BstMAI GTCTC 1 cut(s) 101
BstMBI GATC 1 cut(s) 131
BstNSI RCATGY 1 cut(s) 47
BstSFI CTRYAG 1 cut(s) 217
BstV2I GAAGAC 2 cut(s) 78, 191
BstX2I RGATCY 1 cut(s) 131
BstYI RGATCY 1 cut(s) 131
BtgI CCRYGG 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 102
CviAII CATG 3 cut(s) 44, 118, 157
CviJI RGCY 2 cut(s) 35, 148
CviKI_1 RGCY 2 cut(s) 35, 148
DdeI CTNAG 4 cut(s) 51, 105, 203, 236
DpnI GATC 1 cut(s) 133
DpnII GATC 1 cut(s) 131
Eco130I CCWWGG 1 cut(s) 156
Eco32I GATATC 1 cut(s) 214
EcoRV GATATC 1 cut(s) 214
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
FaeI CATG 3 cut(s) 47, 121, 160
FaiI YATR 7 cut(s) 45, 66, 119, 144, 158, 180, 219
FatI CATG 3 cut(s) 43, 117, 156
GsaI CCCAGC 1 cut(s) 35
Hin1II CATG 3 cut(s) 47, 121, 160
HindIII AAGCTT 1 cut(s) 146
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 237
Hpy8I GTNNAC 1 cut(s) 81
HpyAV CCTTC 1 cut(s) 145
HpyF3I CTNAG 4 cut(s) 51, 105, 203, 236
Hsp92II CATG 3 cut(s) 47, 121, 160
Kzo9I GATC 1 cut(s) 131
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 1 cut(s) 45
MalI GATC 1 cut(s) 133
MboI GATC 1 cut(s) 131
MboII GAAGA 3 cut(s) 83, 141, 191
MflI RGATCY 1 cut(s) 131
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 1 cut(s) 191
MnlI CCTC 1 cut(s) 114
MseI TTAA 3 cut(s) 150, 186, 231
NcoI CCATGG 1 cut(s) 156
NdeII GATC 1 cut(s) 131
NlaIII CATG 3 cut(s) 47, 121, 160
NspI RCATGY 1 cut(s) 47
PspFI CCCAGC 1 cut(s) 31
PsuI RGATCY 1 cut(s) 131
SaqAI TTAA 3 cut(s) 150, 186, 231
Sau3AI GATC 1 cut(s) 131
SduI GDGCHC 1 cut(s) 18
SetI ASST 3 cut(s) 37, 150, 170
SfcI CTRYAG 1 cut(s) 217
SgeI CNNG 9 cut(s) 44, 52, 56, 88, 123, 130, 151, 169, 185
Sse9I AATT 1 cut(s) 191
StyI CCWWGG 1 cut(s) 156
TasI AATT 1 cut(s) 191
Tru1I TTAA 3 cut(s) 150, 186, 231
Tru9I TTAA 3 cut(s) 150, 186, 231
TscAI CASTG 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 216
TspRI CASTG 1 cut(s) 109
XapI RAATTY 1 cut(s) 191
XceI RCATGY 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.