Rh6AG173900

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
N/A
Physical Location & Seq
Reverse (-)
28170949 .. 28171173
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG173900.1

Sequence Viewer

Length: 225 bp
ATGGATAGACTTAGCAACTTTCCAGACGAGTTAGTAGACAAAATTTTATGTATTTTGCCAATTCAGCAGGCTGTGAAGACATGTGTTTTATCAAGCACATGGCGGTATACATCAAATAGGCTTTCACAACTTGTGTTCGATTGGAAGCATAACGGGAATTGGAGCAACCCAGAGTTTGTCGAAATGGTTGATCACGTACTCTCAAATCATGTTGGGCCCATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.58

Weight (kDa)

5.79

Isoelectric Point (pI)

13.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 4 - 41 8.6e-06 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 36, 107
AciI CCGC 1 cut(s) 103
AcsI RAATTY 1 cut(s) 42
AfaI GTAC 1 cut(s) 198
AflIII ACRYGT 1 cut(s) 80
AoxI GGCC 1 cut(s) 215
ApaI GGGCCC 1 cut(s) 219
ApoI RAATTY 1 cut(s) 42
AspS9I GGNCC 2 cut(s) 215, 216
BaeGI GKGCMC 1 cut(s) 219
BanII GRGCYC 1 cut(s) 219
BbsI GAAGAC 1 cut(s) 83
BclI TGATCA 1 cut(s) 190
BmgT120I GGNCC 2 cut(s) 215, 216
BmiI GGNNCC 1 cut(s) 217
BpiI GAAGAC 1 cut(s) 83
BsaAI YACGTR 1 cut(s) 196
BseSI GKGCMC 1 cut(s) 219
BshFI GGCC 1 cut(s) 217
BsnI GGCC 1 cut(s) 217
Bsp120I GGGCCC 1 cut(s) 215
Bsp1286I GDGCHC 1 cut(s) 219
Bsp143I GATC 1 cut(s) 190
BspACI CCGC 1 cut(s) 103
BspANI GGCC 1 cut(s) 217
BspLI GGNNCC 1 cut(s) 217
BssMI GATC 1 cut(s) 190
BssNAI GTATAC 1 cut(s) 108
Bst1107I GTATAC 1 cut(s) 108
BstBAI YACGTR 1 cut(s) 196
BstC8I GCNNGC 1 cut(s) 69
BstDEI CTNAG 1 cut(s) 11
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstNSI RCATGY 1 cut(s) 84
BstSLI GKGCMC 1 cut(s) 219
BstV2I GAAGAC 1 cut(s) 83
BstZ17I GTATAC 1 cut(s) 108
BsuRI GGCC 1 cut(s) 217
Cac8I GCNNGC 1 cut(s) 69
Cfr13I GGNCC 2 cut(s) 215, 216
Csp6I GTAC 1 cut(s) 197
CviAII CATG 3 cut(s) 81, 99, 209
CviJI RGCY 3 cut(s) 71, 121, 217
CviKI_1 RGCY 3 cut(s) 71, 121, 217
CviQI GTAC 1 cut(s) 197
DdeI CTNAG 1 cut(s) 11
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eco24I GRGCYC 1 cut(s) 219
EcoT38I GRGCYC 1 cut(s) 219
FaeI CATG 3 cut(s) 84, 102, 212
FaiI YATR 8 cut(s) 49, 82, 100, 108, 150, 210, 221, 223
FatI CATG 3 cut(s) 80, 98, 208
FbaI TGATCA 1 cut(s) 190
FblI GTMKAC 2 cut(s) 36, 107
FriOI GRGCYC 1 cut(s) 219
HaeIII GGCC 1 cut(s) 217
Hin1II CATG 3 cut(s) 84, 102, 212
Hpy166II GTNNAC 2 cut(s) 37, 108
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 2 cut(s) 37, 108
HpyCH4IV ACGT 1 cut(s) 195
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
HpyF3I CTNAG 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 195
Hsp92II CATG 3 cut(s) 84, 102, 212
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 1 cut(s) 190
LmnI GCTCC 1 cut(s) 162
LpnPI CCDG 3 cut(s) 36, 53, 183
MaeII ACGT 1 cut(s) 195
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 1 cut(s) 88
MhlI GDGCHC 1 cut(s) 219
MluCI AATT 3 cut(s) 42, 60, 157
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeII GATC 1 cut(s) 190
NlaIII CATG 3 cut(s) 84, 102, 212
NlaIV GGNNCC 1 cut(s) 217
NspI RCATGY 1 cut(s) 84
PciI ACATGT 1 cut(s) 80
Ppu21I YACGTR 1 cut(s) 196
PscI ACATGT 1 cut(s) 80
PspN4I GGNNCC 1 cut(s) 217
PspOMI GGGCCC 1 cut(s) 215
PspPI GGNCC 2 cut(s) 215, 216
RsaI GTAC 1 cut(s) 198
RsaNI GTAC 1 cut(s) 197
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 2 cut(s) 215, 216
SduI GDGCHC 1 cut(s) 219
SetI ASST 1 cut(s) 198
Sse9I AATT 3 cut(s) 42, 60, 157
SsiI CCGC 1 cut(s) 103
TaiI ACGT 1 cut(s) 198
TaqI TCGA 2 cut(s) 138, 180
TasI AATT 3 cut(s) 42, 60, 157
XapI RAATTY 1 cut(s) 42
XceI RCATGY 1 cut(s) 84
XmiI GTMKAC 2 cut(s) 36, 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.