Rh6AG182400

calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
N/A
Physical Location & Seq
Reverse (-)
31952190 .. 31968675
16486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG182400.1

Sequence Viewer

Length: 219 bp
ATGAAGATAGGACTTTTCATTCTAACTTTGCCTATTGATTCAGAAAGACTTTCAGAGGAAGAAATTGGTGGTTTAAAGGAGTTGTTCAAGATGATTGACACGGATAATAGTGGGACAATAACATTTGAGGAACTTAAAGTGGGTTTGAAAAAAGTGGGCTCAGACCTAATGGAATCTGAAATCAAGTCTCTTATGGAAGCAGTTAATAGAGCACCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.0

Weight (kDa)

4.61

Isoelectric Point (pI)

42.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_1 PF00036 25 - 51 3.2e-09 EF hand domain
EF-hand_6 PF13405 25 - 53 1.4e-08 EF-hand domain
EF-hand_5 PF13202 25 - 46 3.8e-07 EF hand
EF-hand_7 PF13499 25 - 68 4.1e-07 EF-hand domain pair
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 88, 148
Alw21I GWGCWC 1 cut(s) 214
Alw26I GTCTC 1 cut(s) 192
BanII GRGCYC 1 cut(s) 161
Bbv12I GWGCWC 1 cut(s) 214
BcoDI GTCTC 1 cut(s) 192
BseMII CTCAG 1 cut(s) 174
BsiHKAI GWGCWC 1 cut(s) 214
BslFI GGGAC 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 192
BsmFI GGGAC 1 cut(s) 127
Bsp1286I GDGCHC 2 cut(s) 161, 214
BspCNI CTCAG 1 cut(s) 173
BstDEI CTNAG 1 cut(s) 160
BstMAI GTCTC 1 cut(s) 192
CviJI RGCY 1 cut(s) 159
CviKI_1 RGCY 1 cut(s) 159
DdeI CTNAG 1 cut(s) 160
DraI TTTAAA 1 cut(s) 75
Eco24I GRGCYC 1 cut(s) 161
EcoT38I GRGCYC 1 cut(s) 161
FaiI YATR 2 cut(s) 194, 217
FaqI GGGAC 1 cut(s) 127
FriOI GRGCYC 1 cut(s) 161
HinfI GANTC 2 cut(s) 38, 173
Hpy188I TCNGA 4 cut(s) 43, 55, 163, 178
Hpy188III TCNNGA 1 cut(s) 88
HpyF3I CTNAG 1 cut(s) 160
MboII GAAGA 2 cut(s) 16, 71
MhlI GDGCHC 2 cut(s) 161, 214
MluCI AATT 1 cut(s) 63
MnlI CCTC 2 cut(s) 49, 121
MseI TTAA 3 cut(s) 74, 135, 204
PfeI GAWTC 2 cut(s) 38, 173
SaqAI TTAA 3 cut(s) 74, 135, 204
SduI GDGCHC 2 cut(s) 161, 214
SetI ASST 1 cut(s) 168
SgeI CNNG 3 cut(s) 100, 112, 196
Sse9I AATT 1 cut(s) 63
TasI AATT 1 cut(s) 63
TfiI GAWTC 2 cut(s) 38, 173
Tru1I TTAA 3 cut(s) 74, 135, 204
Tru9I TTAA 3 cut(s) 74, 135, 204
TspDTI ATGAA 2 cut(s) 7, 17
TspGWI ACGGA 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.