Rh6BG127000

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
N/A
Physical Location & Seq
Reverse (-)
19777969 .. 19778295
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG127000.1

Sequence Viewer

Length: 327 bp
ATGGCCAACAAAATTAAAGATCATCCTGGATCGACAGCGGCCATTCCTTCCAAAGTGGAAGATGGCATTTGTAACATCATGTGTCTTTGCAGTCTTACTGGATCCTTTGTTCTTTTATATTCCTATTGTCAACAAGGATATGAAGTGCGTTGGCTTGGACAAAATTTGAAGGCAATAGTTATTTCATTACGATCAGCAACGGATCTCTTTTATATACTGGACATTGCTATTACAATTTATAGTGAACCTAAAGGTCCAACATATAGGGTTATGGGGGAGATCATATCGGCATACAATGGCCTTGACAAAAGGAATGATATTAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

11.96

Weight (kDa)

6.53

Isoelectric Point (pI)

37.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 38
AclWI GGATC 4 cut(s) 37, 96, 109, 210
AcoI YGGCCR 2 cut(s) 3, 39
AcsI RAATTY 1 cut(s) 163
AgsI TTSAA 1 cut(s) 169
AjnI CCWGG 1 cut(s) 25
AloI GAACNNNNNNTCC 2 cut(s) 93, 125
AlwI GGATC 4 cut(s) 37, 96, 109, 210
AoxI GGCC 3 cut(s) 3, 39, 298
ApoI RAATTY 1 cut(s) 163
AspS9I GGNCC 1 cut(s) 254
AvaII GGWCC 1 cut(s) 254
BalI TGGCCA 1 cut(s) 5
BamHI GGATCC 1 cut(s) 101
BccI CCATC 1 cut(s) 56
BciT130I CCWGG 1 cut(s) 27
BisI GCNGC 1 cut(s) 39
BlsI GCNGC 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 27
Bme18I GGWCC 1 cut(s) 254
BmgT120I GGNCC 1 cut(s) 254
BmiI GGNNCC 1 cut(s) 103
BmrFI CCNGG 1 cut(s) 27
Bse1I ACTGG 2 cut(s) 103, 222
Bse3DI GCAATG 1 cut(s) 222
BseBI CCWGG 1 cut(s) 27
BseGI GGATG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 222
BseNI ACTGG 2 cut(s) 103, 222
BshFI GGCC 3 cut(s) 5, 41, 300
BsnI GGCC 3 cut(s) 5, 41, 300
Bsp143I GATC 6 cut(s) 19, 29, 101, 191, 202, 279
BspACI CCGC 1 cut(s) 38
BspANI GGCC 3 cut(s) 5, 41, 300
BspLI GGNNCC 1 cut(s) 103
BspPI GGATC 4 cut(s) 37, 96, 109, 210
BsrDI GCAATG 1 cut(s) 222
BsrI ACTGG 2 cut(s) 103, 222
BssMI GATC 6 cut(s) 19, 29, 101, 191, 202, 279
Bst2UI CCWGG 1 cut(s) 27
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 6 cut(s) 22, 32, 104, 194, 205, 282
BstMBI GATC 6 cut(s) 19, 29, 101, 191, 202, 279
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 1 cut(s) 25
BstX2I RGATCY 2 cut(s) 101, 202
BstYI RGATCY 2 cut(s) 101, 202
BsuRI GGCC 3 cut(s) 5, 41, 300
BtsCI GGATG 1 cut(s) 22
Cfr13I GGNCC 1 cut(s) 254
CviAII CATG 1 cut(s) 79
CviJI RGCY 4 cut(s) 5, 41, 154, 300
CviKI_1 RGCY 4 cut(s) 5, 41, 154, 300
DpnI GATC 6 cut(s) 21, 31, 103, 193, 204, 281
DpnII GATC 6 cut(s) 19, 29, 101, 191, 202, 279
EaeI YGGCCR 2 cut(s) 3, 39
Eco47I GGWCC 1 cut(s) 254
EcoRII CCWGG 1 cut(s) 25
FaeI CATG 1 cut(s) 82
FatI CATG 1 cut(s) 78
Fnu4HI GCNGC 1 cut(s) 39
FokI GGATG 1 cut(s) 9
Fsp4HI GCNGC 1 cut(s) 39
GluI GCNGC 1 cut(s) 39
HaeIII GGCC 3 cut(s) 5, 41, 300
Hin1II CATG 1 cut(s) 82
HincII GTYRAC 1 cut(s) 131
HindII GTYRAC 1 cut(s) 131
Hpy166II GTNNAC 2 cut(s) 131, 245
Hpy8I GTNNAC 2 cut(s) 131, 245
HpyAV CCTTC 2 cut(s) 57, 163
HpyCH4V TGCA 1 cut(s) 90
Hsp92II CATG 1 cut(s) 82
Kzo9I GATC 6 cut(s) 19, 29, 101, 191, 202, 279
LpnPI CCDG 4 cut(s) 12, 39, 84, 203
MaeIII GTNAC 1 cut(s) 71
MalI GATC 6 cut(s) 21, 31, 103, 193, 204, 281
MboI GATC 6 cut(s) 19, 29, 101, 191, 202, 279
MboII GAAGA 1 cut(s) 71
MflI RGATCY 2 cut(s) 101, 202
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 12, 163, 234
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 281
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 15
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 27
MvaI CCWGG 1 cut(s) 27
NdeII GATC 6 cut(s) 19, 29, 101, 191, 202, 279
NlaIII CATG 1 cut(s) 82
NlaIV GGNNCC 1 cut(s) 103
PfoI TCCNGGA 1 cut(s) 25
PkrI GCNGC 1 cut(s) 40
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 103
PspPI GGNCC 1 cut(s) 254
PsuI RGATCY 2 cut(s) 101, 202
SaqAI TTAA 1 cut(s) 15
SatI GCNGC 1 cut(s) 39
Sau3AI GATC 6 cut(s) 19, 29, 101, 191, 202, 279
Sau96I GGNCC 1 cut(s) 254
ScrFI CCNGG 1 cut(s) 27
SetI ASST 2 cut(s) 250, 256
SgeI CNNG 8 cut(s) 38, 39, 91, 111, 146, 167, 230, 314
SinI GGWCC 1 cut(s) 254
Sse9I AATT 3 cut(s) 12, 163, 234
SsiI CCGC 1 cut(s) 38
StyD4I CCNGG 1 cut(s) 25
TaqI TCGA 1 cut(s) 32
TasI AATT 3 cut(s) 12, 163, 234
TauI GCSGC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TspDTI ATGAA 2 cut(s) 156, 174
TspGWI ACGGA 1 cut(s) 215
VpaK11BI GGWCC 1 cut(s) 254
XapI RAATTY 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.