Rh6BG508600

F-box-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
N/A
Physical Location & Seq
Reverse (-)
70545466 .. 70545914
449 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG508600.1

Sequence Viewer

Length: 330 bp
ATGGATATCCTGGAGACCGCTCAAAAAGTGTGCTCAAAGTGGTACAAAACTTGTAAGGACCCAATAATGTGGCGCATCATTGACATGGGCAATGACTATTATATGGATATTCGCAATTGCAGGCCCTTCTACTGGTATGGCTTGTGTAAAAGTGCCATTGGACGTAGCTGTGGTAATTTGGTTGATATCAATATCGAGAACTTTGGCACCAATTCTCTCCTCTGCTGTCTTGCTGAGAGGATTAAATTTGTGAATCTCCATTGGTGCTTGAGCTTCCAAGACCTTGAAAATGTGTCTGCTATGAATAGGATTAGGAAATGGGGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like LRR_6

Protein Analysis

109

Amino Acids

12.86

Weight (kDa)

8.44

Isoelectric Point (pI)

33.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 206
AccBSI CCGCTC 1 cut(s) 20
AciI CCGC 1 cut(s) 18
AcsI RAATTY 1 cut(s) 245
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 132
AgsI TTSAA 1 cut(s) 287
AjnI CCWGG 1 cut(s) 9
AluBI AGCT 2 cut(s) 168, 273
AluI AGCT 2 cut(s) 168, 273
Alw21I GWGCWC 1 cut(s) 35
Alw26I GTCTC 1 cut(s) 8
AoxI GGCC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 245
AspLEI GCGC 1 cut(s) 75
AspS9I GGNCC 2 cut(s) 58, 123
AvaII GGWCC 1 cut(s) 58
BanI GGYRCC 1 cut(s) 206
Bbv12I GWGCWC 1 cut(s) 35
BciT130I CCWGG 1 cut(s) 11
BcoDI GTCTC 1 cut(s) 8
Bme1390I CCNGG 1 cut(s) 11
Bme18I GGWCC 1 cut(s) 58
BmgT120I GGNCC 2 cut(s) 58, 123
BmiI GGNNCC 2 cut(s) 60, 208
BmrFI CCNGG 1 cut(s) 11
BmsI GCATC 1 cut(s) 84
BpmI CTGGAG 1 cut(s) 32
BpuEI CTTGAG 1 cut(s) 289
BsaI GGTCTC 1 cut(s) 8
Bsc4I CCNNNNNNNGG 1 cut(s) 132
Bse1I ACTGG 1 cut(s) 137
Bse3DI GCAATG 1 cut(s) 97
BseBI CCWGG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 132
BseMI GCAATG 1 cut(s) 97
BseMII CTCAG 1 cut(s) 225
BseNI ACTGG 1 cut(s) 137
BseRI GAGGAG 1 cut(s) 209
BshFI GGCC 1 cut(s) 124
BshNI GGYRCC 1 cut(s) 206
BsiHKAI GWGCWC 1 cut(s) 35
BslI CCNNNNNNNGG 1 cut(s) 132
BsmAI GTCTC 1 cut(s) 8
BsnI GGCC 1 cut(s) 124
Bso31I GGTCTC 1 cut(s) 8
Bsp1286I GDGCHC 1 cut(s) 35
BspACI CCGC 1 cut(s) 18
BspANI GGCC 1 cut(s) 124
BspCNI CTCAG 1 cut(s) 226
BspLI GGNNCC 2 cut(s) 60, 208
BspT107I GGYRCC 1 cut(s) 206
BspTNI GGTCTC 1 cut(s) 8
BsrBI CCGCTC 1 cut(s) 20
BsrDI GCAATG 1 cut(s) 97
BsrI ACTGG 1 cut(s) 137
Bst2UI CCWGG 1 cut(s) 11
BstC8I GCNNGC 1 cut(s) 122
BstDEI CTNAG 1 cut(s) 234
BstHHI GCGC 1 cut(s) 75
BstMAI GTCTC 1 cut(s) 8
BstNI CCWGG 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 9
BstXI CCANNNNNNTGG 1 cut(s) 69
BsuRI GGCC 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 122
CfoI GCGC 1 cut(s) 75
Cfr13I GGNCC 2 cut(s) 58, 123
Csp6I GTAC 1 cut(s) 43
CviAII CATG 1 cut(s) 85
CviJI RGCY 4 cut(s) 124, 141, 168, 273
CviKI_1 RGCY 4 cut(s) 124, 141, 168, 273
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 1 cut(s) 234
Eco31I GGTCTC 1 cut(s) 8
Eco32I GATATC 2 cut(s) 7, 187
Eco47I GGWCC 1 cut(s) 58
EcoO109I RGGNCCY 2 cut(s) 58, 123
EcoRII CCWGG 1 cut(s) 9
EcoRV GATATC 2 cut(s) 7, 187
FaeI CATG 1 cut(s) 88
FaiI YATR 5 cut(s) 86, 102, 104, 138, 302
FatI CATG 1 cut(s) 84
GlaI GCGC 1 cut(s) 74
GsuI CTGGAG 1 cut(s) 32
HaeIII GGCC 1 cut(s) 124
HhaI GCGC 1 cut(s) 75
Hin1II CATG 1 cut(s) 88
Hin6I GCGC 1 cut(s) 73
HinP1I GCGC 1 cut(s) 73
HinfI GANTC 1 cut(s) 253
Hpy188III TCNNGA 1 cut(s) 196
HpyAV CCTTC 1 cut(s) 136
HpyCH4IV ACGT 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 234
HpySE526I ACGT 1 cut(s) 163
Hsp92II CATG 1 cut(s) 88
HspAI GCGC 1 cut(s) 73
LpnPI CCDG 3 cut(s) 23, 106, 118
LweI GCATC 1 cut(s) 84
MaeII ACGT 1 cut(s) 163
MbiI CCGCTC 1 cut(s) 20
MfeI CAATTG 1 cut(s) 115
MhlI GDGCHC 1 cut(s) 35
MluCI AATT 4 cut(s) 115, 175, 211, 245
MnlI CCTC 2 cut(s) 230, 231
MseI TTAA 1 cut(s) 243
MslI CAYNNNNRTG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 11
MunI CAATTG 1 cut(s) 115
MvaI CCWGG 1 cut(s) 11
NlaIII CATG 1 cut(s) 88
NlaIV GGNNCC 2 cut(s) 60, 208
PfeI GAWTC 1 cut(s) 253
PfoI TCCNGGA 1 cut(s) 9
PpuMI RGGWCCY 1 cut(s) 58
Psp5II RGGWCCY 1 cut(s) 58
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
PspN4I GGNNCC 2 cut(s) 60, 208
PspPI GGNCC 2 cut(s) 58, 123
PspPPI RGGWCCY 1 cut(s) 58
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
RseI CAYNNNNRTG 1 cut(s) 83
SaqAI TTAA 1 cut(s) 243
Sau96I GGNCC 2 cut(s) 58, 123
ScrFI CCNGG 1 cut(s) 11
SduI GDGCHC 1 cut(s) 35
SetI ASST 4 cut(s) 166, 170, 275, 285
SfaNI GCATC 1 cut(s) 84
SinI GGWCC 1 cut(s) 58
SmiMI CAYNNNNRTG 1 cut(s) 83
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
Sse9I AATT 4 cut(s) 115, 175, 211, 245
SsiI CCGC 1 cut(s) 18
StyD4I CCNGG 1 cut(s) 9
TaiI ACGT 1 cut(s) 166
TaqI TCGA 1 cut(s) 195
TasI AATT 4 cut(s) 115, 175, 211, 245
TfiI GAWTC 1 cut(s) 253
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspDTI ATGAA 1 cut(s) 317
VpaK11BI GGWCC 1 cut(s) 58
XapI RAATTY 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.