Rh6CG013600
HSP70 Family

Belongs to the heat shock protein 70 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
N/A
Physical Location & Seq
Forward (+)
1521943 .. 1524539
2597 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG013600.1

Sequence Viewer

Length: 252 bp
ATGGCAATAACAGGAGAAGAAGAAGAGTGTTATGCAATAGGGATCGACTTGGGAACAACCTATTCGTGTGTGGCAGTTTGGCGGAACAATAATGCAGAAATCATACCAAACGATCAGGGCAACAGGACAACTCCATCTTACGTTGCCTTCACTGATAACGAGCGACTGGTAGGTGATGCAACACTTAACCAGGCCATCAGAAATCCCACTACCTCCATATTTGGTAAGGAATGGAAGATCCTTCTCGCATAA
Functional Annotation

Protein Analysis

83

Amino Acids

9.17

Weight (kDa)

4.41

Isoelectric Point (pI)

32.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP70 PF00012 12 - 75 1.7e-25 Hsp70 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 82
AclWI GGATC 2 cut(s) 50, 232
AjnI CCWGG 1 cut(s) 189
AlwI GGATC 2 cut(s) 50, 232
AoxI GGCC 1 cut(s) 192
AsuHPI GGTGA 1 cut(s) 185
BccI CCATC 2 cut(s) 142, 203
BciT130I CCWGG 1 cut(s) 191
Bme1390I CCNGG 1 cut(s) 191
BmrFI CCNGG 1 cut(s) 191
BmsI GCATC 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 171
BseBI CCWGG 1 cut(s) 191
BseNI ACTGG 1 cut(s) 171
BshFI GGCC 1 cut(s) 194
BsnI GGCC 1 cut(s) 194
Bsp143I GATC 3 cut(s) 42, 112, 237
BspACI CCGC 1 cut(s) 82
BspANI GGCC 1 cut(s) 194
BspPI GGATC 2 cut(s) 50, 232
BsrI ACTGG 1 cut(s) 171
BssMI GATC 3 cut(s) 42, 112, 237
Bst2UI CCWGG 1 cut(s) 191
Bst6I CTCTTC 1 cut(s) 18
BstKTI GATC 3 cut(s) 45, 115, 240
BstMBI GATC 3 cut(s) 42, 112, 237
BstNI CCWGG 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 189
BstX2I RGATCY 1 cut(s) 237
BstYI RGATCY 1 cut(s) 237
BsuRI GGCC 1 cut(s) 194
BtsIMutI CAGTG 1 cut(s) 150
CviJI RGCY 1 cut(s) 194
CviKI_1 RGCY 1 cut(s) 194
DpnI GATC 3 cut(s) 44, 114, 239
DpnII GATC 3 cut(s) 42, 112, 237
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
EciI GGCGGA 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 189
FaiI YATR 4 cut(s) 33, 104, 218, 250
HaeIII GGCC 1 cut(s) 194
HphI GGTGA 1 cut(s) 185
Hpy188I TCNGA 1 cut(s) 200
HpyAV CCTTC 2 cut(s) 157, 251
HpyCH4IV ACGT 1 cut(s) 141
HpyCH4V TGCA 3 cut(s) 35, 95, 179
HpySE526I ACGT 1 cut(s) 141
Kzo9I GATC 3 cut(s) 42, 112, 237
LpnPI CCDG 5 cut(s) 101, 109, 152, 176, 203
LweI GCATC 1 cut(s) 166
MaeII ACGT 1 cut(s) 141
MalI GATC 3 cut(s) 44, 114, 239
MboI GATC 3 cut(s) 42, 112, 237
MboII GAAGA 4 cut(s) 29, 32, 35, 247
MflI RGATCY 1 cut(s) 237
MnlI CCTC 1 cut(s) 223
MseI TTAA 1 cut(s) 186
MspR9I CCNGG 1 cut(s) 191
MvaI CCWGG 1 cut(s) 191
NdeII GATC 3 cut(s) 42, 112, 237
Psp6I CCWGG 1 cut(s) 189
PspGI CCWGG 1 cut(s) 189
PsuI RGATCY 1 cut(s) 237
SaqAI TTAA 1 cut(s) 186
Sau3AI GATC 3 cut(s) 42, 112, 237
ScrFI CCNGG 1 cut(s) 191
SetI ASST 4 cut(s) 62, 144, 175, 215
SfaNI GCATC 1 cut(s) 166
SgeI CNNG 9 cut(s) 24, 61, 78, 128, 136, 172, 179, 202, 203
SsiI CCGC 1 cut(s) 82
StyD4I CCNGG 1 cut(s) 189
TaiI ACGT 1 cut(s) 144
TaqI TCGA 1 cut(s) 45
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 1 cut(s) 157
TspRI CASTG 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.