Rh6CG113600

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
N/A
Physical Location & Seq
Forward (+)
13040312 .. 13040690
379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG113600.1

Sequence Viewer

Length: 297 bp
ATGCATCGCTGGTCTGGAATTCAACTGGATGTGAACAAATTTTGTGGCTATTATGCTGAAATTGAAAGGACAAGAGCAAGTGGTACAACTGAACAAGATAGGATTGTGGAAGCCAAACAAAAGTTTAGGAGGGAGCGAGGATACAACTTTACATATGAGCATTGTTGGCATGTGTTGAAGTTCCACCCGAAATGGAACTTGGAACTCTCTAGGAAAGAACCAAAGAAAACTCATGCTACGGTTCCTGCTACTTTGTCTTCTATCACTCCATCTGCTAGCCCAGATATAATAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.54

Weight (kDa)

9.23

Isoelectric Point (pI)

59.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 50 - 92 7.1e-08 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 18, 38
AfaI GTAC 1 cut(s) 85
AgsI TTSAA 3 cut(s) 23, 65, 178
AjuI GAANNNNNNNTTGG 2 cut(s) 182, 214
ApoI RAATTY 2 cut(s) 18, 38
AsuNHI GCTAGC 1 cut(s) 275
BbsI GAAGAC 1 cut(s) 249
BccI CCATC 1 cut(s) 277
BciVI GTATCC 1 cut(s) 134
BfaI CTAG 2 cut(s) 210, 276
BfuI GTATCC 1 cut(s) 134
BmiI GGNNCC 1 cut(s) 243
BmsI GCATC 1 cut(s) 13
BmtI GCTAGC 1 cut(s) 279
BpiI GAAGAC 1 cut(s) 249
Bse1I ACTGG 1 cut(s) 30
BseGI GGATG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 30
BspLI GGNNCC 1 cut(s) 243
BspOI GCTAGC 1 cut(s) 279
BsrI ACTGG 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 241
BstC8I GCNNGC 1 cut(s) 277
BstF5I GGATG 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 166
BstNSI RCATGY 1 cut(s) 173
BstV2I GAAGAC 1 cut(s) 249
BsuI GTATCC 1 cut(s) 134
BtsCI GGATG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 277
Csp6I GTAC 1 cut(s) 84
CspCI CAANNNNNGTGG 2 cut(s) 25, 60
CviAII CATG 2 cut(s) 170, 233
CviJI RGCY 3 cut(s) 48, 113, 279
CviKI_1 RGCY 3 cut(s) 48, 113, 279
CviQI GTAC 1 cut(s) 84
EcoRI GAATTC 1 cut(s) 18
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 173, 236
FaiI YATR 6 cut(s) 54, 154, 156, 171, 234, 287
FatI CATG 2 cut(s) 169, 232
FauNDI CATATG 1 cut(s) 154
FokI GGATG 1 cut(s) 41
FspBI CTAG 2 cut(s) 210, 276
Hin1II CATG 2 cut(s) 173, 236
Hpy166II GTNNAC 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 15
Hpy8I GTNNAC 1 cut(s) 34
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
Hsp92II CATG 2 cut(s) 173, 236
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 2 cut(s) 11, 258
LweI GCATC 1 cut(s) 13
MaeI CTAG 2 cut(s) 210, 276
MboII GAAGA 1 cut(s) 249
MluCI AATT 3 cut(s) 18, 38, 60
MnlI CCTC 2 cut(s) 123, 131
Mph1103I ATGCAT 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 166
NdeI CATATG 1 cut(s) 154
NheI GCTAGC 1 cut(s) 275
NlaIII CATG 2 cut(s) 173, 236
NlaIV GGNNCC 1 cut(s) 243
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 173
PspN4I GGNNCC 1 cut(s) 243
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SfaNI GCATC 1 cut(s) 13
Sse9I AATT 3 cut(s) 18, 38, 60
SspMI CTAG 2 cut(s) 210, 276
TaaI ACNGT 1 cut(s) 241
TasI AATT 3 cut(s) 18, 38, 60
XapI RAATTY 2 cut(s) 18, 38
XceI RCATGY 1 cut(s) 173
XspI CTAG 2 cut(s) 210, 276
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.