Rh6CG188100
TCP Family

1-phosphatidylinositol-3-phosphate 5-kinase FAB1D

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
N/A
Physical Location & Seq
Reverse (-)
30608163 .. 30608552
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG188100.1

Sequence Viewer

Length: 390 bp
ATGGTCAGATTACAAAGTCTGTTTCTATTTCAACATCTCCAGAGGCGACTGATCAGTGTGATGTTGAAGATAGAGGAAGTTCTGATGAAGAGATCGAGGCCACTTAGTGGTGGAGAAATCCAGTCTCCATTTACTTGCACTGAAGCTTCTCTGGAGATTGAAAAGGATGGTGGCAACAATGAAGACCCAATGCAGAGCAAGAATGACATCAGCAAAGTGTTGGATTCCCAGAGTATTTTGGTTTTGATGTCGAGCAAGAATGTTAAAGGGAATGTTTGTGAGCAAAGCCATTTTTCTCATATCATGTTCTACAAGAATTTTGATGTGCCCATCGAAAAGTTTCTACAGGATAATATACTGAATCAGGTTCGTCACAACTCTATTTATTAG

Protein Analysis

129

Amino Acids

14.9

Weight (kDa)

6.9

Isoelectric Point (pI)

95.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 107
AcsI RAATTY 1 cut(s) 316
AcuI CTGAAG 1 cut(s) 162
AdeI CACNNNGTG 1 cut(s) 107
AfiI CCNNNNNNNGG 1 cut(s) 107
AgsI TTSAA 3 cut(s) 32, 67, 161
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw26I GTCTC 1 cut(s) 129
AoxI GGCC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 316
Asp700I GAANNNNTTC 1 cut(s) 339
BaeGI GKGCMC 1 cut(s) 330
BbsI GAAGAC 1 cut(s) 189
BccI CCATC 2 cut(s) 161, 338
BclI TGATCA 1 cut(s) 51
BcoDI GTCTC 1 cut(s) 129
BfmI CTRYAG 1 cut(s) 344
BpiI GAAGAC 1 cut(s) 189
BpmI CTGGAG 2 cut(s) 23, 173
Bsc4I CCNNNNNNNGG 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 121
BseGI GGATG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 107
BseNI ACTGG 1 cut(s) 121
BseSI GKGCMC 1 cut(s) 330
BshFI GGCC 1 cut(s) 100
BslI CCNNNNNNNGG 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 129
BsnI GGCC 1 cut(s) 100
Bsp1286I GDGCHC 1 cut(s) 330
Bsp143I GATC 2 cut(s) 51, 92
BspANI GGCC 1 cut(s) 100
BsrI ACTGG 1 cut(s) 121
BssMI GATC 2 cut(s) 51, 92
Bst6I CTCTTC 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 104
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 2 cut(s) 54, 95
BstMAI GTCTC 1 cut(s) 129
BstMBI GATC 2 cut(s) 51, 92
BstSFI CTRYAG 1 cut(s) 344
BstSLI GKGCMC 1 cut(s) 330
BstV2I GAAGAC 1 cut(s) 189
BsuRI GGCC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 172
BtsIMutI CAGTG 2 cut(s) 61, 138
CviAII CATG 1 cut(s) 304
CviJI RGCY 3 cut(s) 100, 146, 288
CviKI_1 RGCY 3 cut(s) 100, 146, 288
DdeI CTNAG 1 cut(s) 104
DpnI GATC 2 cut(s) 53, 94
DpnII GATC 2 cut(s) 51, 92
DraIII CACNNNGTG 1 cut(s) 107
Eam1104I CTCTTC 1 cut(s) 83
EarI CTCTTC 1 cut(s) 83
Eco57I CTGAAG 1 cut(s) 162
FaeI CATG 1 cut(s) 307
FaiI YATR 3 cut(s) 300, 305, 356
FatI CATG 1 cut(s) 303
FbaI TGATCA 1 cut(s) 51
FokI GGATG 1 cut(s) 179
GsuI CTGGAG 2 cut(s) 23, 173
HaeIII GGCC 1 cut(s) 100
Hin1II CATG 1 cut(s) 307
HindIII AAGCTT 1 cut(s) 144
HinfI GANTC 2 cut(s) 224, 361
Hpy188I TCNGA 2 cut(s) 8, 84
Hpy188III TCNNGA 2 cut(s) 40, 152
HpyCH4V TGCA 2 cut(s) 138, 193
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 1 cut(s) 307
Ksp22I TGATCA 1 cut(s) 51
Kzo9I GATC 2 cut(s) 51, 92
LpnPI CCDG 6 cut(s) 53, 134, 137, 242, 332, 350
MaeIII GTNAC 1 cut(s) 371
MalI GATC 2 cut(s) 53, 94
MboI GATC 2 cut(s) 51, 92
MboII GAAGA 3 cut(s) 79, 100, 194
MhlI GDGCHC 1 cut(s) 330
MluCI AATT 1 cut(s) 316
MmeI TCCRAC 1 cut(s) 201
MnlI CCTC 3 cut(s) 36, 67, 90
MroXI GAANNNNTTC 1 cut(s) 339
MseI TTAA 1 cut(s) 264
NdeII GATC 2 cut(s) 51, 92
NlaIII CATG 1 cut(s) 307
NmuCI GTSAC 1 cut(s) 371
PdmI GAANNNNTTC 1 cut(s) 339
PfeI GAWTC 2 cut(s) 224, 361
PflMI CCANNNNNTGG 1 cut(s) 107
SaqAI TTAA 1 cut(s) 264
Sau3AI GATC 2 cut(s) 51, 92
SduI GDGCHC 1 cut(s) 330
SetI ASST 2 cut(s) 148, 369
SfcI CTRYAG 1 cut(s) 344
Sse9I AATT 1 cut(s) 316
TaqI TCGA 3 cut(s) 95, 251, 333
TasI AATT 1 cut(s) 316
TfiI GAWTC 2 cut(s) 224, 361
Tru1I TTAA 1 cut(s) 264
Tru9I TTAA 1 cut(s) 264
TscAI CASTG 2 cut(s) 61, 145
TseFI GTSAC 1 cut(s) 371
Tsp45I GTSAC 1 cut(s) 371
TspDTI ATGAA 2 cut(s) 101, 195
TspRI CASTG 2 cut(s) 61, 145
Van91I CCANNNNNTGG 1 cut(s) 107
XapI RAATTY 1 cut(s) 316
XmnI GAANNNNTTC 1 cut(s) 339
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.