Rh6DG068400

Disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
N/A
Physical Location & Seq
Reverse (-)
6982547 .. 6988014
5468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG068400.1

Sequence Viewer

Length: 444 bp
ATGACTTTGTTCGGTGTTCCCTCGCTTGGTCCAGTGATCATCTTACTCGGATCTGAATGGTTTGAATGGTTCTCCGCAATTGACCTTTGGAGCACCAAAAATAAAAAAATAAAAAAGCTCCAAGAGAAACTAGGATCTGTCAACCAAGCTTTGTCTGCTAAGGAATTCAAGCTTCTCTGCTCTAAGTTGGCTTGTTTTCTTGGCCGTCAATTTAGAAAGCTTGAGGCGAAGTGGAATGATCATAAAGAATCTGTGGATAGTGCTGAAATGAGTGGAGACAAAATCAAGCATGAGGTTCGAGCATGGCTAACAGAAGCTGATAATGCCATGACAAATGAACCGAGTCACAATCCATACATCCCTATGGTAGCAAGTGAACAATCACATTCTCAAATTGCTTCAAGATGTGCAGAAGAAAGGGATGGTGAAATCCAATGGTCCTGA

Protein Analysis

147

Amino Acids

16.71

Weight (kDa)

6.43

Isoelectric Point (pI)

39.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 75
AclWI GGATC 2 cut(s) 58, 142
AcoI YGGCCR 1 cut(s) 202
AcsI RAATTY 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 26
AgsI TTSAA 3 cut(s) 65, 169, 402
AluBI AGCT 5 cut(s) 118, 149, 172, 220, 317
AluI AGCT 5 cut(s) 118, 149, 172, 220, 317
Alw21I GWGCWC 1 cut(s) 95
Alw26I GTCTC 1 cut(s) 270
AlwI GGATC 2 cut(s) 58, 142
AlwNI CAGNNNCTG 1 cut(s) 317
AoxI GGCC 1 cut(s) 202
ApoI RAATTY 1 cut(s) 164
AspS9I GGNCC 2 cut(s) 29, 438
AsuHPI GGTGA 1 cut(s) 437
AvaII GGWCC 2 cut(s) 29, 438
Bbv12I GWGCWC 1 cut(s) 95
BccI CCATC 1 cut(s) 416
BceAI ACGGC 1 cut(s) 189
BcgI CGANNNNNNTGC 2 cut(s) 278, 312
BclI TGATCA 2 cut(s) 36, 238
BcoDI GTCTC 1 cut(s) 270
BfaI CTAG 1 cut(s) 131
Bme18I GGWCC 2 cut(s) 29, 438
BmgT120I GGNCC 2 cut(s) 29, 438
Bpu10I CCTNAGC 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 242
Bsc4I CCNNNNNNNGG 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 32
BseGI GGATG 2 cut(s) 357, 427
BseLI CCNNNNNNNGG 1 cut(s) 26
BseNI ACTGG 1 cut(s) 32
BsgI GTGCAG 1 cut(s) 429
BshFI GGCC 1 cut(s) 204
BsiHKAI GWGCWC 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 26
BsmAI GTCTC 1 cut(s) 270
BsnI GGCC 1 cut(s) 204
Bsp1286I GDGCHC 1 cut(s) 95
Bsp143I GATC 4 cut(s) 36, 50, 134, 238
BspACI CCGC 1 cut(s) 75
BspANI GGCC 1 cut(s) 204
BspPI GGATC 2 cut(s) 58, 142
BsrI ACTGG 1 cut(s) 32
BssMI GATC 4 cut(s) 36, 50, 134, 238
BstDEI CTNAG 2 cut(s) 159, 183
BstF5I GGATG 2 cut(s) 357, 427
BstKTI GATC 4 cut(s) 39, 53, 137, 241
BstMAI GTCTC 1 cut(s) 270
BstMBI GATC 4 cut(s) 36, 50, 134, 238
BstMWI GCNNNNNNNGC 2 cut(s) 155, 323
BstX2I RGATCY 2 cut(s) 50, 134
BstYI RGATCY 2 cut(s) 50, 134
BsuRI GGCC 1 cut(s) 204
BtsCI GGATG 2 cut(s) 357, 427
BtsIMutI CAGTG 1 cut(s) 39
CaiI CAGNNNCTG 1 cut(s) 317
Cfr13I GGNCC 2 cut(s) 29, 438
CviAII CATG 3 cut(s) 290, 303, 328
CviJI RGCY 8 cut(s) 118, 149, 172, 191, 204, 220, 307, 317
CviKI_1 RGCY 8 cut(s) 118, 149, 172, 191, 204, 220, 307, 317
DdeI CTNAG 2 cut(s) 159, 183
DpnI GATC 4 cut(s) 38, 52, 136, 240
DpnII GATC 4 cut(s) 36, 50, 134, 238
EaeI YGGCCR 1 cut(s) 202
Eco47I GGWCC 2 cut(s) 29, 438
EcoRI GAATTC 1 cut(s) 164
FaeI CATG 3 cut(s) 293, 306, 331
FaiI YATR 6 cut(s) 243, 291, 304, 329, 355, 365
FatI CATG 3 cut(s) 289, 302, 327
FbaI TGATCA 2 cut(s) 36, 238
FokI GGATG 2 cut(s) 344, 434
FspBI CTAG 1 cut(s) 131
HaeIII GGCC 1 cut(s) 204
Hin1II CATG 3 cut(s) 293, 306, 331
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HindIII AAGCTT 3 cut(s) 147, 170, 218
HinfI GANTC 2 cut(s) 248, 343
HphI GGTGA 1 cut(s) 437
Hpy166II GTNNAC 2 cut(s) 142, 377
Hpy188I TCNGA 2 cut(s) 50, 55
Hpy188III TCNNGA 2 cut(s) 402, 441
Hpy8I GTNNAC 2 cut(s) 142, 377
HpyCH4V TGCA 1 cut(s) 410
HpyF10VI GCNNNNNNNGC 2 cut(s) 155, 323
HpyF3I CTNAG 2 cut(s) 159, 183
Hsp92II CATG 3 cut(s) 293, 306, 331
Ksp22I TGATCA 2 cut(s) 36, 238
Kzo9I GATC 4 cut(s) 36, 50, 134, 238
LmnI GCTCC 2 cut(s) 90, 123
LpnPI CCDG 1 cut(s) 45
MaeI CTAG 1 cut(s) 131
MaeIII GTNAC 1 cut(s) 344
MalI GATC 4 cut(s) 38, 52, 136, 240
MboI GATC 4 cut(s) 36, 50, 134, 238
MboII GAAGA 1 cut(s) 425
MfeI CAATTG 1 cut(s) 78
MflI RGATCY 2 cut(s) 50, 134
MhlI GDGCHC 1 cut(s) 95
MluCI AATT 4 cut(s) 78, 164, 209, 393
MlyI GAGTC 1 cut(s) 352
MnlI CCTC 3 cut(s) 31, 217, 286
MslI CAYNNNNRTG 1 cut(s) 362
MunI CAATTG 1 cut(s) 78
MwoI GCNNNNNNNGC 2 cut(s) 155, 323
NdeII GATC 4 cut(s) 36, 50, 134, 238
NlaIII CATG 3 cut(s) 293, 306, 331
NmuCI GTSAC 1 cut(s) 344
PfeI GAWTC 1 cut(s) 248
PleI GAGTC 1 cut(s) 351
PpsI GAGTC 1 cut(s) 351
PspPI GGNCC 2 cut(s) 29, 438
PstNI CAGNNNCTG 1 cut(s) 317
PsuI RGATCY 2 cut(s) 50, 134
RseI CAYNNNNRTG 1 cut(s) 362
Sau3AI GATC 4 cut(s) 36, 50, 134, 238
Sau96I GGNCC 2 cut(s) 29, 438
SchI GAGTC 1 cut(s) 352
SduI GDGCHC 1 cut(s) 95
SetI ASST 7 cut(s) 87, 120, 151, 174, 222, 297, 319
SinI GGWCC 2 cut(s) 29, 438
SmiMI CAYNNNNRTG 1 cut(s) 362
SmlI CTYRAG 1 cut(s) 221
SmoI CTYRAG 1 cut(s) 221
Sse9I AATT 4 cut(s) 78, 164, 209, 393
SsiI CCGC 1 cut(s) 75
SspMI CTAG 1 cut(s) 131
TaqI TCGA 1 cut(s) 298
TasI AATT 4 cut(s) 78, 164, 209, 393
TfiI GAWTC 1 cut(s) 248
TscAI CASTG 1 cut(s) 39
TseFI GTSAC 1 cut(s) 344
Tsp45I GTSAC 1 cut(s) 344
TspDTI ATGAA 1 cut(s) 351
TspRI CASTG 1 cut(s) 39
VpaK11BI GGWCC 2 cut(s) 29, 438
XapI RAATTY 1 cut(s) 164
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.