Rh6DG145000
BZIP Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
N/A
Physical Location & Seq
Reverse (-)
20999334 .. 20999706
373 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG145000.1

Sequence Viewer

Length: 228 bp
ATGTCTCTAAAGAACTTTAGGACTTTAGAGATAAATATGAATGCGGCTCATCAAGAAGCACTGAAGAGGGAAATAGAAAGACTAAAGCAAGCGTATCACCAACAGAATCTCAAGAAGATGGACAACAACAACATTGAACAATCACCAAACTTGGACATCATAACTGCTCAACATCCTGATCCTGCTGCTGCTGATCAGAAAGAACAACTTCTCAATGTTTCTTCCTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.64

Weight (kDa)

6.26

Isoelectric Point (pI)

68.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AclWI GGATC 1 cut(s) 173
AcuI CTGAAG 1 cut(s) 83
AgsI TTSAA 1 cut(s) 137
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 1 cut(s) 173
ApeKI GCWGC 2 cut(s) 185, 188
Asp700I GAANNNNTTC 1 cut(s) 207
AsuHPI GGTGA 2 cut(s) 89, 135
BbvI GCAGC 2 cut(s) 172, 175
BccI CCATC 1 cut(s) 112
BclI TGATCA 1 cut(s) 193
BcoDI GTCTC 1 cut(s) 9
BisI GCNGC 3 cut(s) 45, 186, 189
BlsI GCNGC 3 cut(s) 46, 187, 190
BpuEI CTTGAG 1 cut(s) 95
BseGI GGATG 1 cut(s) 172
BseXI GCAGC 2 cut(s) 172, 175
BsmAI GTCTC 1 cut(s) 9
BsmI GAATGC 1 cut(s) 46
Bsp143I GATC 2 cut(s) 178, 193
BspACI CCGC 1 cut(s) 44
BspPI GGATC 1 cut(s) 173
BssMI GATC 2 cut(s) 178, 193
Bst6I CTCTTC 1 cut(s) 59
BstC8I GCNNGC 1 cut(s) 90
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 2 cut(s) 181, 196
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 2 cut(s) 178, 193
BstV1I GCAGC 2 cut(s) 172, 175
BtsCI GGATG 1 cut(s) 172
BtsIMutI CAGTG 1 cut(s) 59
Cac8I GCNNGC 1 cut(s) 90
CviJI RGCY 1 cut(s) 47
CviKI_1 RGCY 1 cut(s) 47
DpnI GATC 2 cut(s) 180, 195
DpnII GATC 2 cut(s) 178, 193
Eam1104I CTCTTC 1 cut(s) 59
EarI CTCTTC 1 cut(s) 59
Eco57I CTGAAG 1 cut(s) 83
FaiI YATR 2 cut(s) 38, 161
FalI AAGNNNNNCTT 2 cut(s) 192, 224
FbaI TGATCA 1 cut(s) 193
Fnu4HI GCNGC 3 cut(s) 45, 186, 189
FokI GGATG 1 cut(s) 159
Fsp4HI GCNGC 3 cut(s) 45, 186, 189
GluI GCNGC 3 cut(s) 45, 186, 189
HinfI GANTC 1 cut(s) 106
HphI GGTGA 2 cut(s) 89, 135
Hpy188I TCNGA 1 cut(s) 198
Hpy188III TCNNGA 4 cut(s) 53, 112, 176, 225
Ksp22I TGATCA 1 cut(s) 193
Kzo9I GATC 2 cut(s) 178, 193
LpnPI CCDG 2 cut(s) 189, 195
Lsp1109I GCAGC 2 cut(s) 172, 175
MalI GATC 2 cut(s) 180, 195
MboI GATC 2 cut(s) 178, 193
MboII GAAGA 3 cut(s) 76, 127, 213
MnlI CCTC 1 cut(s) 60
MroXI GAANNNNTTC 1 cut(s) 207
Mva1269I GAATGC 1 cut(s) 46
NdeII GATC 2 cut(s) 178, 193
PctI GAATGC 1 cut(s) 46
PdmI GAANNNNTTC 1 cut(s) 207
PfeI GAWTC 1 cut(s) 106
PkrI GCNGC 3 cut(s) 46, 187, 190
SatI GCNGC 3 cut(s) 45, 186, 189
Sau3AI GATC 2 cut(s) 178, 193
SgeI CNNG 6 cut(s) 65, 101, 124, 163, 188, 194
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
SsiI CCGC 1 cut(s) 44
TauI GCSGC 1 cut(s) 47
TfiI GAWTC 1 cut(s) 106
TscAI CASTG 1 cut(s) 66
TseI GCWGC 2 cut(s) 185, 188
TspDTI ATGAA 1 cut(s) 53
TspRI CASTG 1 cut(s) 66
XmnI GAANNNNTTC 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.