Rh6DG242100

ADP binding

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
N/A
Physical Location & Seq
Forward (+)
42961053 .. 42961322
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG242100.1

Sequence Viewer

Length: 270 bp
ATGAGAAACATTCAAACATTGCGTCTAAGGGGTTTAGAACTCGGATCGAAAACAATGTCTATGACTGGGGAGCTACGGACACTCACGATACTCCACCTATGTGAATCTCGCATAGAGCGTGTACTTGAGGAATTCAAAAACTTGTGCAATCTAAAGTTGCCAGATTTGGCAGAATGTTGGTCACTTCAAGAAATCTCACCAGGTGTCATATCAAGTTTATACAAACTAGAAGATATTGTACTTGTGGGGTATAGTCGAGGAGTGGGATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.08

Weight (kDa)

6.57

Isoelectric Point (pI)

57.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 52
AcsI RAATTY 1 cut(s) 131
AdeI CACNNNGTG 1 cut(s) 203
AfaI GTAC 2 cut(s) 123, 240
AgsI TTSAA 3 cut(s) 14, 136, 188
AjnI CCWGG 1 cut(s) 199
AleI CACNNNNGTG 1 cut(s) 99
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
AlwI GGATC 1 cut(s) 52
ApoI RAATTY 1 cut(s) 131
ArsI GACNNNNNNTTYG 4 cut(s) 7, 39, 41, 73
AsuHPI GGTGA 1 cut(s) 189
BarI GAAGNNNNNNTAC 2 cut(s) 222, 254
BciT130I CCWGG 1 cut(s) 201
BfaI CTAG 1 cut(s) 227
Bme1390I CCNGG 1 cut(s) 201
BmrFI CCNGG 1 cut(s) 201
BmrI ACTGGG 1 cut(s) 75
BmuI ACTGGG 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 70
Bse3DI GCAATG 1 cut(s) 17
BseBI CCWGG 1 cut(s) 201
BseMI GCAATG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 70
Bsp143I GATC 1 cut(s) 44
BspPI GGATC 1 cut(s) 52
BsrDI GCAATG 1 cut(s) 17
BsrI ACTGG 1 cut(s) 70
BssMI GATC 1 cut(s) 44
Bst2UI CCWGG 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 26
BstKTI GATC 1 cut(s) 47
BstMBI GATC 1 cut(s) 44
BstNI CCWGG 1 cut(s) 201
BstSCI CCNGG 1 cut(s) 199
CseI GACGC 1 cut(s) 11
CsiI ACCWGGT 1 cut(s) 199
Csp6I GTAC 2 cut(s) 122, 239
CviJI RGCY 1 cut(s) 73
CviKI_1 RGCY 1 cut(s) 73
CviQI GTAC 2 cut(s) 122, 239
DdeI CTNAG 1 cut(s) 26
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
DraIII CACNNNGTG 1 cut(s) 203
EcoRI GAATTC 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 199
FaiI YATR 6 cut(s) 62, 100, 113, 209, 220, 252
FspBI CTAG 1 cut(s) 227
HgaI GACGC 1 cut(s) 11
HinfI GANTC 1 cut(s) 104
HphI GGTGA 1 cut(s) 189
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 44
Hpy188III TCNNGA 2 cut(s) 85, 188
Hpy8I GTNNAC 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 147
HpyF3I CTNAG 1 cut(s) 26
Kzo9I GATC 1 cut(s) 44
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 4 cut(s) 51, 174, 186, 213
MabI ACCWGGT 1 cut(s) 199
MaeI CTAG 1 cut(s) 227
MaeIII GTNAC 1 cut(s) 180
MalI GATC 1 cut(s) 46
MboI GATC 1 cut(s) 44
MboII GAAGA 1 cut(s) 242
MluCI AATT 1 cut(s) 131
MnlI CCTC 2 cut(s) 121, 251
MslI CAYNNNNRTG 1 cut(s) 99
MspR9I CCNGG 1 cut(s) 201
MvaI CCWGG 1 cut(s) 201
NdeII GATC 1 cut(s) 44
NmuCI GTSAC 1 cut(s) 180
OliI CACNNNNGTG 1 cut(s) 99
PcsI WCGNNNNNNNCGW 1 cut(s) 115
PfeI GAWTC 1 cut(s) 104
Psp6I CCWGG 1 cut(s) 199
PspGI CCWGG 1 cut(s) 199
RsaI GTAC 2 cut(s) 123, 240
RsaNI GTAC 2 cut(s) 122, 239
RseI CAYNNNNRTG 1 cut(s) 99
Sau3AI GATC 1 cut(s) 44
ScrFI CCNGG 1 cut(s) 201
SetI ASST 3 cut(s) 75, 99, 205
SexAI ACCWGGT 1 cut(s) 199
SmiMI CAYNNNNRTG 1 cut(s) 99
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 1 cut(s) 131
SspMI CTAG 1 cut(s) 227
StyD4I CCNGG 1 cut(s) 199
TaqI TCGA 2 cut(s) 47, 256
TasI AATT 1 cut(s) 131
TatI WGTACW 2 cut(s) 121, 238
TfiI GAWTC 1 cut(s) 104
TseFI GTSAC 1 cut(s) 180
Tsp45I GTSAC 1 cut(s) 180
TspGWI ACGGA 1 cut(s) 91
XapI RAATTY 1 cut(s) 131
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.