Rh6DG452100

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
N/A
Physical Location & Seq
Reverse (-)
62401147 .. 62402049
903 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG452100.1

Sequence Viewer

Length: 354 bp
ATGGGCCTAACTGGCCTGATTGACATTGACACGCTCTCAGAGTTGCCGGCCCTCAAGACCATAAGCTTCATGAACAACGGCTTTGGAGGTCCACTGCCCGATGTGAAGAGACTTTCACTCATTAGTGTCTACTTATCCGAGAACCAATTCTCTGGTGATATCCCGGATGATGCTTTCAGTGGCATGGGTGATACCTTGAAGAAAGTTTACTTGGCCAAAAATGGATTTACGGGGAAGATACCGAGTTCTTTGGTTGATTTGCCTAAGCTCATTGAGTTGGACCTTGGGGATAACCAGTTTAGTGGGAAGATACCAAATTTTCAACCAAGGAACTGGACGTTTTACAGACCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

117

Amino Acids

12.84

Weight (kDa)

4.91

Isoelectric Point (pI)

13.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_8 PF13855 40 - 100 1.2e-06 Leucine rich repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 129
AcoI YGGCCR 1 cut(s) 213
AcsI RAATTY 1 cut(s) 316
AgsI TTSAA 2 cut(s) 199, 323
AjuI GAANNNNNNNTTGG 2 cut(s) 194, 226
AluBI AGCT 2 cut(s) 66, 268
AluI AGCT 2 cut(s) 66, 268
Alw26I GTCTC 1 cut(s) 103
AoxI GGCC 4 cut(s) 4, 13, 48, 213
ApoI RAATTY 1 cut(s) 316
Asp700I GAANNNNTTC 1 cut(s) 146
AspS9I GGNCC 4 cut(s) 4, 49, 89, 280
AsuC2I CCSGG 1 cut(s) 164
AsuHPI GGTGA 2 cut(s) 167, 200
AvaII GGWCC 2 cut(s) 89, 280
BalI TGGCCA 1 cut(s) 215
BarI GAAGNNNNNNTAC 2 cut(s) 191, 223
BceAI ACGGC 1 cut(s) 94
BcnI CCSGG 1 cut(s) 164
BcoDI GTCTC 1 cut(s) 103
BglI GCCNNNNNGGC 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 164
Bme18I GGWCC 2 cut(s) 89, 280
BmgT120I GGNCC 4 cut(s) 4, 49, 89, 280
BmrFI CCNGG 1 cut(s) 164
BmsI GCATC 1 cut(s) 160
Bpu10I CCTNAGC 1 cut(s) 264
BpuEI CTTGAG 1 cut(s) 38
BpuMI CCSGG 1 cut(s) 164
BsaJI CCNNGG 2 cut(s) 283, 326
Bse118I RCCGGY 1 cut(s) 46
Bse1I ACTGG 3 cut(s) 16, 295, 338
BseDI CCNNGG 2 cut(s) 283, 326
BseGI GGATG 1 cut(s) 172
BseMII CTCAG 1 cut(s) 51
BseNI ACTGG 3 cut(s) 16, 295, 338
BshFI GGCC 4 cut(s) 6, 15, 50, 215
BsiSI CCGG 2 cut(s) 47, 164
BsmAI GTCTC 1 cut(s) 103
BsnI GGCC 4 cut(s) 6, 15, 50, 215
BspANI GGCC 4 cut(s) 6, 15, 50, 215
BspCNI CTCAG 1 cut(s) 50
BspHI TCATGA 1 cut(s) 69
BsrFI RCCGGY 1 cut(s) 46
BsrI ACTGG 3 cut(s) 16, 295, 338
BssAI RCCGGY 1 cut(s) 46
BssECI CCNNGG 2 cut(s) 283, 326
BssT1I CCWWGG 2 cut(s) 283, 326
Bst6I CTCTTC 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 2 cut(s) 37, 264
BstF5I GGATG 1 cut(s) 172
BstMAI GTCTC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 162
BstXI CCANNNNNNTGG 3 cut(s) 152, 302, 333
BsuRI GGCC 4 cut(s) 6, 15, 50, 215
BtsCI GGATG 1 cut(s) 172
BtsI GCAGTG 1 cut(s) 92
BtsIMutI CAGTG 2 cut(s) 92, 184
Cac8I GCNNGC 1 cut(s) 48
CciI TCATGA 1 cut(s) 69
Cfr10I RCCGGY 1 cut(s) 46
Cfr13I GGNCC 4 cut(s) 4, 49, 89, 280
CviAII CATG 2 cut(s) 70, 184
CviJI RGCY 7 cut(s) 6, 15, 50, 66, 81, 215, 268
CviKI_1 RGCY 7 cut(s) 6, 15, 50, 66, 81, 215, 268
DdeI CTNAG 2 cut(s) 37, 264
EaeI YGGCCR 1 cut(s) 213
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
Eco130I CCWWGG 2 cut(s) 283, 326
Eco32I GATATC 1 cut(s) 160
Eco47I GGWCC 2 cut(s) 89, 280
EcoRV GATATC 1 cut(s) 160
EcoT14I CCWWGG 2 cut(s) 283, 326
ErhI CCWWGG 2 cut(s) 283, 326
FaeI CATG 2 cut(s) 73, 187
FaiI YATR 3 cut(s) 62, 71, 185
FatI CATG 2 cut(s) 69, 183
FblI GTMKAC 1 cut(s) 129
FokI GGATG 1 cut(s) 179
HaeIII GGCC 4 cut(s) 6, 15, 50, 215
HapII CCGG 2 cut(s) 47, 164
Hin1II CATG 2 cut(s) 73, 187
HindIII AAGCTT 1 cut(s) 64
HpaII CCGG 2 cut(s) 47, 164
HphI GGTGA 2 cut(s) 167, 200
Hpy166II GTNNAC 3 cut(s) 92, 130, 208
Hpy188I TCNGA 2 cut(s) 40, 139
Hpy188III TCNNGA 2 cut(s) 55, 70
Hpy8I GTNNAC 3 cut(s) 92, 130, 208
HpyCH4IV ACGT 1 cut(s) 338
HpyF10VI GCNNNNNNNGC 1 cut(s) 12
HpyF3I CTNAG 2 cut(s) 37, 264
HpySE526I ACGT 1 cut(s) 338
Hsp92II CATG 2 cut(s) 73, 187
KroI GCCGGC 1 cut(s) 46
KroNI GCCGGC 1 cut(s) 48
LpnPI CCDG 6 cut(s) 29, 60, 138, 177, 308, 319
LweI GCATC 1 cut(s) 160
MaeII ACGT 1 cut(s) 338
MboII GAAGA 4 cut(s) 118, 211, 247, 319
MlsI TGGCCA 1 cut(s) 215
MluCI AATT 2 cut(s) 146, 316
MluNI TGGCCA 1 cut(s) 215
MmeI TCCRAC 1 cut(s) 258
MnlI CCTC 2 cut(s) 62, 80
Mox20I TGGCCA 1 cut(s) 215
MroNI GCCGGC 1 cut(s) 46
MroXI GAANNNNTTC 1 cut(s) 146
MscI TGGCCA 1 cut(s) 215
Msp20I TGGCCA 1 cut(s) 215
MspI CCGG 2 cut(s) 47, 164
MspR9I CCNGG 1 cut(s) 164
MwoI GCNNNNNNNGC 1 cut(s) 12
NaeI GCCGGC 1 cut(s) 48
NciI CCSGG 1 cut(s) 164
NgoMIV GCCGGC 1 cut(s) 46
NlaIII CATG 2 cut(s) 73, 187
PagI TCATGA 1 cut(s) 69
PdiI GCCGGC 1 cut(s) 48
PdmI GAANNNNTTC 1 cut(s) 146
PfoI TCCNGGA 1 cut(s) 162
PspPI GGNCC 4 cut(s) 4, 49, 89, 280
Sau96I GGNCC 4 cut(s) 4, 49, 89, 280
ScrFI CCNGG 1 cut(s) 164
SetI ASST 6 cut(s) 68, 91, 197, 270, 285, 341
SfaNI GCATC 1 cut(s) 160
SfiI GGCCNNNNNGGCC 1 cut(s) 12
SinI GGWCC 2 cut(s) 89, 280
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 2 cut(s) 146, 316
StyD4I CCNGG 1 cut(s) 162
StyI CCWWGG 2 cut(s) 283, 326
TaiI ACGT 1 cut(s) 341
TasI AATT 2 cut(s) 146, 316
TscAI CASTG 2 cut(s) 99, 184
TspDTI ATGAA 2 cut(s) 58, 86
TspRI CASTG 2 cut(s) 99, 184
VpaK11BI GGWCC 2 cut(s) 89, 280
XapI RAATTY 1 cut(s) 316
XmiI GTMKAC 1 cut(s) 129
XmnI GAANNNNTTC 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.