Rh6DG452200

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
N/A
Physical Location & Seq
Reverse (-)
62407021 .. 62407287
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG452200.1

Sequence Viewer

Length: 267 bp
ATGGCTCATAATAAAGCAGCATATGATCACTGGCTTATCATGCTATGTGTTTTAGTATTTGCTAGTTCATCATGTTCTGCTACTGAAGGTGACACACTCATCAAGTTCAAGACTTCTCTATCCGATACCTGGGCACTAGATAACTGGAATTCTTCTACAAAACCCTGCAACGGTTTCACGAGCCATTGGGCGGGTGTGCTTTGTAACGGCGGGATCGAGCGTATTCGGGCTGCAGCTGCAGAACATGGGCCTAACTGGCCTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

88

Amino Acids

9.6

Weight (kDa)

6.01

Isoelectric Point (pI)

15.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRRNT_2 PF08263 27 - 69 4.8e-08 Leucine rich repeat N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 191, 210
AclWI GGATC 1 cut(s) 221
AcsI RAATTY 1 cut(s) 148
AcuI CTGAAG 1 cut(s) 105
AfiI CCNNNNNNNGG 3 cut(s) 129, 170, 190
AgsI TTSAA 1 cut(s) 109
AjnI CCWGG 1 cut(s) 128
AluBI AGCT 1 cut(s) 236
AluI AGCT 1 cut(s) 236
AlwI GGATC 1 cut(s) 221
AoxI GGCC 2 cut(s) 248, 257
ApeKI GCWGC 4 cut(s) 17, 230, 233, 236
ApoI RAATTY 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 248
AsuHPI GGTGA 1 cut(s) 101
BaeGI GKGCMC 1 cut(s) 136
BauI CACGAG 1 cut(s) 178
BbvI GCAGC 4 cut(s) 29, 217, 223, 245
BceAI ACGGC 1 cut(s) 223
BciT130I CCWGG 1 cut(s) 130
BclI TGATCA 1 cut(s) 25
BfaI CTAG 2 cut(s) 63, 137
BfmI CTRYAG 2 cut(s) 231, 237
BglI GCCNNNNNGGC 1 cut(s) 256
BisI GCNGC 4 cut(s) 18, 231, 234, 237
BlsI GCNGC 4 cut(s) 19, 232, 235, 238
Bme1390I CCNGG 1 cut(s) 130
BmgT120I GGNCC 1 cut(s) 248
BmrFI CCNGG 1 cut(s) 130
BsaJI CCNNGG 1 cut(s) 129
Bsc4I CCNNNNNNNGG 3 cut(s) 129, 170, 190
Bse1I ACTGG 3 cut(s) 35, 149, 260
BseBI CCWGG 1 cut(s) 130
BseDI CCNNGG 1 cut(s) 129
BseLI CCNNNNNNNGG 3 cut(s) 129, 170, 190
BseNI ACTGG 3 cut(s) 35, 149, 260
BseSI GKGCMC 1 cut(s) 136
BseXI GCAGC 4 cut(s) 29, 217, 223, 245
BshFI GGCC 2 cut(s) 250, 259
BslI CCNNNNNNNGG 3 cut(s) 129, 170, 190
BsnI GGCC 2 cut(s) 250, 259
Bsp1286I GDGCHC 1 cut(s) 136
Bsp143I GATC 2 cut(s) 25, 213
BspACI CCGC 2 cut(s) 191, 210
BspANI GGCC 2 cut(s) 250, 259
BspMAI CTGCAG 2 cut(s) 235, 241
BspPI GGATC 1 cut(s) 221
BsrI ACTGG 3 cut(s) 35, 149, 260
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 2 cut(s) 25, 213
BssSI CACGAG 1 cut(s) 178
Bst2BI CACGAG 1 cut(s) 178
Bst2UI CCWGG 1 cut(s) 130
Bst4CI ACNGT 1 cut(s) 173
BstKTI GATC 2 cut(s) 28, 216
BstMBI GATC 2 cut(s) 25, 213
BstMWI GCNNNNNNNGC 3 cut(s) 40, 236, 256
BstNI CCWGG 1 cut(s) 130
BstSCI CCNGG 1 cut(s) 128
BstSFI CTRYAG 2 cut(s) 231, 237
BstSLI GKGCMC 1 cut(s) 136
BstV1I GCAGC 4 cut(s) 29, 217, 223, 245
BsuRI GGCC 2 cut(s) 250, 259
BtsIMutI CAGTG 1 cut(s) 28
Cfr13I GGNCC 1 cut(s) 248
CviAII CATG 3 cut(s) 40, 72, 245
CviJI RGCY 7 cut(s) 5, 34, 183, 230, 236, 250, 259
CviKI_1 RGCY 7 cut(s) 5, 34, 183, 230, 236, 250, 259
DpnI GATC 2 cut(s) 27, 215
DpnII GATC 2 cut(s) 25, 213
Eco57I CTGAAG 1 cut(s) 105
EcoRI GAATTC 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 128
FaeI CATG 3 cut(s) 43, 75, 248
FaiI YATR 7 cut(s) 9, 22, 24, 41, 46, 73, 246
FatI CATG 3 cut(s) 39, 71, 244
FauI CCCGC 2 cut(s) 184, 203
FauNDI CATATG 1 cut(s) 22
FbaI TGATCA 1 cut(s) 25
Fnu4HI GCNGC 4 cut(s) 18, 231, 234, 237
Fsp4HI GCNGC 4 cut(s) 18, 231, 234, 237
FspBI CTAG 2 cut(s) 63, 137
GluI GCNGC 4 cut(s) 18, 231, 234, 237
HaeIII GGCC 2 cut(s) 250, 259
Hin1II CATG 3 cut(s) 43, 75, 248
HphI GGTGA 1 cut(s) 101
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 109, 178
HpyAV CCTTC 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4V TGCA 3 cut(s) 168, 233, 239
HpyF10VI GCNNNNNNNGC 3 cut(s) 40, 236, 256
Hsp92II CATG 3 cut(s) 43, 75, 248
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 2 cut(s) 25, 213
LpnPI CCDG 6 cut(s) 16, 115, 130, 142, 178, 241
Lsp1109I GCAGC 4 cut(s) 29, 217, 223, 245
MaeI CTAG 2 cut(s) 63, 137
MaeIII GTNAC 2 cut(s) 89, 203
MalI GATC 2 cut(s) 27, 215
MboI GATC 2 cut(s) 25, 213
MboII GAAGA 1 cut(s) 144
MhlI GDGCHC 1 cut(s) 136
MluCI AATT 1 cut(s) 148
MspA1I CMGCKG 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 130
MvaI CCWGG 1 cut(s) 130
MwoI GCNNNNNNNGC 3 cut(s) 40, 236, 256
NdeI CATATG 1 cut(s) 22
NdeII GATC 2 cut(s) 25, 213
NlaIII CATG 3 cut(s) 43, 75, 248
NmuCI GTSAC 1 cut(s) 89
PcsI WCGNNNNNNNCGW 1 cut(s) 213
PkrI GCNGC 4 cut(s) 19, 232, 235, 238
Psp6I CCWGG 1 cut(s) 128
PspGI CCWGG 1 cut(s) 128
PspPI GGNCC 1 cut(s) 248
PstI CTGCAG 2 cut(s) 235, 241
PvuII CAGCTG 1 cut(s) 236
SatI GCNGC 4 cut(s) 18, 231, 234, 237
Sau3AI GATC 2 cut(s) 25, 213
Sau96I GGNCC 1 cut(s) 248
ScrFI CCNGG 1 cut(s) 130
SduI GDGCHC 1 cut(s) 136
SetI ASST 3 cut(s) 91, 131, 238
SfcI CTRYAG 2 cut(s) 231, 237
SfiI GGCCNNNNNGGCC 1 cut(s) 256
Sse9I AATT 1 cut(s) 148
SsiI CCGC 2 cut(s) 191, 210
SspMI CTAG 2 cut(s) 63, 137
StyD4I CCNGG 1 cut(s) 128
TaaI ACNGT 1 cut(s) 173
TaqI TCGA 1 cut(s) 216
TasI AATT 1 cut(s) 148
TscAI CASTG 1 cut(s) 35
TseFI GTSAC 1 cut(s) 89
TseI GCWGC 4 cut(s) 17, 230, 233, 236
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 57
TspRI CASTG 1 cut(s) 35
XapI RAATTY 1 cut(s) 148
XspI CTAG 2 cut(s) 63, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.