Rh7AG277900
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
N/A
Physical Location & Seq
Forward (+)
29124047 .. 29128567
4521 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG277900.1

Sequence Viewer

Length: 255 bp
ATGAGCACGTCTTCTCTAACTTTGTCAGTATCTTTTAACGAGGGCAGTAGCTTTCTTCAAGTATTGCTTACCATAGATGGAGTAAACCAGTTAGGCGGTGGGACCCCTAGGTATGCAACTGTCGATCGCAAATTGGATATGGCTAACCAGGATGCTAAAAAGAATGATAAATACTTGAAGAGCTCTGCCAATCAACAAAAATATCGGCCCCCTGGAAAGAGCAGTCCTAGTGAGTGGATGCATTATGTTGAATAG

Protein Analysis

84

Amino Acids

9.3

Weight (kDa)

9.0

Isoelectric Point (pI)

52.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 96
AgsI TTSAA 3 cut(s) 59, 178, 251
AjiI CACGTC 1 cut(s) 9
AjnI CCWGG 2 cut(s) 147, 211
AluBI AGCT 2 cut(s) 51, 183
AluI AGCT 2 cut(s) 51, 183
Alw21I GWGCWC 2 cut(s) 8, 185
AoxI GGCC 1 cut(s) 206
AspA2I CCTAGG 1 cut(s) 107
AspS9I GGNCC 2 cut(s) 102, 207
AvaII GGWCC 1 cut(s) 102
AvrII CCTAGG 1 cut(s) 107
BanII GRGCYC 1 cut(s) 185
BbsI GAAGAC 1 cut(s) 3
Bbv12I GWGCWC 2 cut(s) 8, 185
BccI CCATC 1 cut(s) 71
BciT130I CCWGG 2 cut(s) 149, 213
BfaI CTAG 2 cut(s) 108, 228
BlnI CCTAGG 1 cut(s) 107
Bme1390I CCNGG 2 cut(s) 149, 213
Bme18I GGWCC 1 cut(s) 102
BmgBI CACGTC 1 cut(s) 9
BmgT120I GGNCC 2 cut(s) 102, 207
BmiI GGNNCC 3 cut(s) 103, 104, 209
BmrFI CCNGG 2 cut(s) 149, 213
BmsI GCATC 2 cut(s) 142, 228
BpiI GAAGAC 1 cut(s) 3
BsaJI CCNNGG 2 cut(s) 107, 211
Bse1I ACTGG 1 cut(s) 88
BseBI CCWGG 2 cut(s) 149, 213
BseDI CCNNGG 2 cut(s) 107, 211
BseGI GGATG 2 cut(s) 157, 243
BseNI ACTGG 1 cut(s) 88
Bsh1285I CGRYCG 1 cut(s) 127
BshFI GGCC 1 cut(s) 208
BsiEI CGRYCG 1 cut(s) 127
BsiHKAI GWGCWC 2 cut(s) 8, 185
BslFI GGGAC 1 cut(s) 115
BsmFI GGGAC 1 cut(s) 115
BsnI GGCC 1 cut(s) 208
Bsp1286I GDGCHC 2 cut(s) 8, 185
Bsp143I GATC 1 cut(s) 124
BspACI CCGC 1 cut(s) 96
BspANI GGCC 1 cut(s) 208
BspLI GGNNCC 3 cut(s) 103, 104, 209
BspQI GCTCTTC 1 cut(s) 173
BsrI ACTGG 1 cut(s) 88
BssECI CCNNGG 2 cut(s) 107, 211
BssMI GATC 1 cut(s) 124
BssT1I CCWWGG 1 cut(s) 107
Bst2UI CCWGG 2 cut(s) 149, 213
Bst4CI ACNGT 1 cut(s) 121
Bst6I CTCTTC 1 cut(s) 173
BstF5I GGATG 2 cut(s) 157, 243
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstMCI CGRYCG 1 cut(s) 127
BstNI CCWGG 2 cut(s) 149, 213
BstSCI CCNGG 2 cut(s) 147, 211
BstV2I GAAGAC 1 cut(s) 3
BsuRI GGCC 1 cut(s) 208
BtrI CACGTC 1 cut(s) 9
BtsCI GGATG 2 cut(s) 157, 243
Cfr13I GGNCC 2 cut(s) 102, 207
CviJI RGCY 4 cut(s) 51, 143, 183, 208
CviKI_1 RGCY 4 cut(s) 51, 143, 183, 208
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
Ecl136II GAGCTC 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 107
Eco24I GRGCYC 1 cut(s) 185
Eco47I GGWCC 1 cut(s) 102
Eco53kI GAGCTC 1 cut(s) 183
EcoICRI GAGCTC 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 102
EcoRII CCWGG 2 cut(s) 147, 211
EcoT14I CCWWGG 1 cut(s) 107
EcoT22I ATGCAT 1 cut(s) 243
EcoT38I GRGCYC 1 cut(s) 185
ErhI CCWWGG 1 cut(s) 107
FaiI YATR 4 cut(s) 74, 114, 140, 246
FalI AAGNNNNNCTT 2 cut(s) 51, 83
FaqI GGGAC 1 cut(s) 115
FokI GGATG 2 cut(s) 164, 250
FriOI GRGCYC 1 cut(s) 185
FspBI CTAG 2 cut(s) 108, 228
HaeIII GGCC 1 cut(s) 208
Hpy166II GTNNAC 1 cut(s) 85
Hpy8I GTNNAC 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4IV ACGT 1 cut(s) 8
HpyCH4V TGCA 2 cut(s) 116, 241
HpySE526I ACGT 1 cut(s) 8
KflI GGGWCCC 1 cut(s) 102
Kzo9I GATC 1 cut(s) 124
LguI GCTCTTC 1 cut(s) 173
LpnPI CCDG 5 cut(s) 101, 134, 161, 198, 225
LweI GCATC 2 cut(s) 142, 228
MaeI CTAG 2 cut(s) 108, 228
MaeII ACGT 1 cut(s) 8
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 3 cut(s) 3, 47, 190
MhlI GDGCHC 2 cut(s) 8, 185
MluCI AATT 1 cut(s) 131
MnlI CCTC 1 cut(s) 34
Mph1103I ATGCAT 1 cut(s) 243
MseI TTAA 1 cut(s) 36
MspR9I CCNGG 2 cut(s) 149, 213
MvaI CCWGG 2 cut(s) 149, 213
NdeII GATC 1 cut(s) 124
NlaIV GGNNCC 3 cut(s) 103, 104, 209
NsiI ATGCAT 1 cut(s) 243
PciSI GCTCTTC 1 cut(s) 173
Ple19I CGATCG 1 cut(s) 127
PpuMI RGGWCCY 1 cut(s) 102
Psp124BI GAGCTC 1 cut(s) 185
Psp5II RGGWCCY 1 cut(s) 102
Psp6I CCWGG 2 cut(s) 147, 211
PspGI CCWGG 2 cut(s) 147, 211
PspN4I GGNNCC 3 cut(s) 103, 104, 209
PspPI GGNCC 2 cut(s) 102, 207
PspPPI RGGWCCY 1 cut(s) 102
PvuI CGATCG 1 cut(s) 127
SacI GAGCTC 1 cut(s) 185
SapI GCTCTTC 1 cut(s) 173
SaqAI TTAA 1 cut(s) 36
Sau3AI GATC 1 cut(s) 124
Sau96I GGNCC 2 cut(s) 102, 207
ScrFI CCNGG 2 cut(s) 149, 213
SduI GDGCHC 2 cut(s) 8, 185
SetI ASST 4 cut(s) 11, 53, 113, 185
SfaNI GCATC 2 cut(s) 142, 228
SinI GGWCC 1 cut(s) 102
Sse9I AATT 1 cut(s) 131
SsiI CCGC 1 cut(s) 96
SspMI CTAG 2 cut(s) 108, 228
SstI GAGCTC 1 cut(s) 185
StyD4I CCNGG 2 cut(s) 147, 211
StyI CCWWGG 1 cut(s) 107
TaaI ACNGT 1 cut(s) 121
TaiI ACGT 1 cut(s) 11
TaqI TCGA 1 cut(s) 123
TasI AATT 1 cut(s) 131
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
VpaK11BI GGWCC 1 cut(s) 102
XcmI CCANNNNNNNNNTGG 1 cut(s) 95
XmaJI CCTAGG 1 cut(s) 107
XspI CTAG 2 cut(s) 108, 228
Zsp2I ATGCAT 1 cut(s) 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.