Rh7BG076500
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
N/A
Physical Location & Seq
Forward (+)
5239373 .. 5241591
2219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG076500.1

Sequence Viewer

Length: 432 bp
ATGAAAGATGTAACAGCAATGCTCAATGAGATCAAGCTTGAAAATGAAGATTGTGAAAAACCAAATTTTCTCGGCCAAGGAGCTGTGACAAACAAGAAAACTGCAGTTTACAATTCTAGTTTCTCCAGGTTTGGAGCAAGGCCTGGTGGTTTGTGGCAGAGAGGAGCGGTCGTAGCGACGACAATTGATGCTGGGATTGCTGACTGCAAAAGAGCAAAATGGTTTGGATGGGGTGGGGTTGACTTAGATTTCTGTTTGGGTCCGCTGCTCCAACTGTTCTCCTTTGGGAGCTGCGACGCAGACACCGTCATTGGCGATTATGAAACTGAGAAGCATCCGAGCCAAGACCACACAGGGTTCCGGCGAGGTTTTGTTGAGAGGTCAAGTCAAGACCCTGTTGCAACAAGTGGAGGAAGAGGCCGAGGTCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_8 Pkinase

Protein Analysis

143

Amino Acids

15.51

Weight (kDa)

6.1

Isoelectric Point (pI)

34.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 167
AciI CCGC 2 cut(s) 167, 263
AcoI YGGCCR 1 cut(s) 73
AcsI RAATTY 1 cut(s) 64
AgsI TTSAA 1 cut(s) 41
AjnI CCWGG 2 cut(s) 125, 142
AluBI AGCT 3 cut(s) 37, 83, 291
AluI AGCT 3 cut(s) 37, 83, 291
AoxI GGCC 3 cut(s) 73, 140, 418
ApeKI GCWGC 2 cut(s) 265, 291
ApoI RAATTY 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 260
AvaII GGWCC 1 cut(s) 260
BbvI GCAGC 2 cut(s) 252, 278
BccI CCATC 1 cut(s) 222
BciT130I CCWGG 2 cut(s) 127, 144
BfaI CTAG 1 cut(s) 117
BfmI CTRYAG 1 cut(s) 102
BisI GCNGC 2 cut(s) 266, 292
BlsI GCNGC 2 cut(s) 267, 293
Bme1390I CCNGG 2 cut(s) 127, 144
Bme18I GGWCC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 260
BmiI GGNNCC 2 cut(s) 261, 359
BmrFI CCNGG 2 cut(s) 127, 144
BmsI GCATC 2 cut(s) 178, 343
BpmI CTGGAG 1 cut(s) 109
BsaJI CCNNGG 2 cut(s) 76, 421
BsaXI ACNNNNNCTCC 2 cut(s) 156, 186
Bse3DI GCAATG 1 cut(s) 24
BseBI CCWGG 2 cut(s) 127, 144
BseDI CCNNGG 2 cut(s) 76, 421
BseGI GGATG 2 cut(s) 233, 334
BseMI GCAATG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 318
BseRI GAGGAG 1 cut(s) 177
BseXI GCAGC 2 cut(s) 252, 278
BseYI CCCAGC 1 cut(s) 191
Bsh1285I CGRYCG 1 cut(s) 171
BshFI GGCC 3 cut(s) 75, 142, 420
BsiEI CGRYCG 1 cut(s) 171
BsiSI CCGG 1 cut(s) 361
BsnI GGCC 3 cut(s) 75, 142, 420
Bsp143I GATC 1 cut(s) 30
BspACI CCGC 2 cut(s) 167, 263
BspANI GGCC 3 cut(s) 75, 142, 420
BspCNI CTCAG 1 cut(s) 319
BspLI GGNNCC 2 cut(s) 261, 359
BspMAI CTGCAG 1 cut(s) 106
BsrBI CCGCTC 1 cut(s) 167
BsrDI GCAATG 1 cut(s) 24
BssECI CCNNGG 2 cut(s) 76, 421
BssMI GATC 1 cut(s) 30
BssT1I CCWWGG 1 cut(s) 76
Bst2UI CCWGG 2 cut(s) 127, 144
Bst4CI ACNGT 2 cut(s) 276, 307
Bst6I CTCTTC 1 cut(s) 409
BstDEI CTNAG 2 cut(s) 244, 327
BstF5I GGATG 2 cut(s) 233, 334
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstMCI CGRYCG 1 cut(s) 171
BstMWI GCNNNNNNNGC 2 cut(s) 173, 197
BstNI CCWGG 2 cut(s) 127, 144
BstSCI CCNGG 2 cut(s) 125, 142
BstSFI CTRYAG 1 cut(s) 102
BstV1I GCAGC 2 cut(s) 252, 278
BsuRI GGCC 3 cut(s) 75, 142, 420
BtsCI GGATG 2 cut(s) 233, 334
Cfr13I GGNCC 1 cut(s) 260
CseI GACGC 1 cut(s) 305
CviJI RGCY 7 cut(s) 37, 75, 83, 142, 291, 342, 420
CviKI_1 RGCY 7 cut(s) 37, 75, 83, 142, 291, 342, 420
DdeI CTNAG 2 cut(s) 244, 327
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
EaeI YGGCCR 1 cut(s) 73
Eam1104I CTCTTC 1 cut(s) 409
EarI CTCTTC 1 cut(s) 409
Eco130I CCWWGG 1 cut(s) 76
Eco147I AGGCCT 1 cut(s) 142
Eco47I GGWCC 1 cut(s) 260
EcoRII CCWGG 2 cut(s) 125, 142
EcoT14I CCWWGG 1 cut(s) 76
ErhI CCWWGG 1 cut(s) 76
FaiI YATR 1 cut(s) 321
Fnu4HI GCNGC 2 cut(s) 266, 292
FokI GGATG 2 cut(s) 240, 321
Fsp4HI GCNGC 2 cut(s) 266, 292
FspBI CTAG 1 cut(s) 117
GluI GCNGC 2 cut(s) 266, 292
GsaI CCCAGC 1 cut(s) 195
GsuI CTGGAG 1 cut(s) 109
HaeIII GGCC 3 cut(s) 75, 142, 420
HapII CCGG 1 cut(s) 361
HgaI GACGC 1 cut(s) 305
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HindIII AAGCTT 1 cut(s) 35
HpaII CCGG 1 cut(s) 361
Hpy166II GTNNAC 2 cut(s) 109, 241
Hpy188I TCNGA 1 cut(s) 339
Hpy188III TCNNGA 1 cut(s) 389
Hpy8I GTNNAC 2 cut(s) 109, 241
Hpy99I CGWCG 2 cut(s) 181, 299
HpyCH4III ACNGT 2 cut(s) 276, 307
HpyCH4V TGCA 3 cut(s) 104, 207, 401
HpyF10VI GCNNNNNNNGC 2 cut(s) 173, 197
HpyF3I CTNAG 2 cut(s) 244, 327
Kzo9I GATC 1 cut(s) 30
LmnI GCTCC 5 cut(s) 80, 134, 164, 273, 288
LpnPI CCDG 8 cut(s) 112, 129, 139, 156, 177, 339, 374, 408
Lsp1109I GCAGC 2 cut(s) 252, 278
LweI GCATC 2 cut(s) 178, 343
MaeI CTAG 1 cut(s) 117
MaeIII GTNAC 2 cut(s) 10, 85
MalI GATC 1 cut(s) 32
MbiI CCGCTC 1 cut(s) 167
MboI GATC 1 cut(s) 30
MboII GAAGA 2 cut(s) 59, 426
MfeI CAATTG 1 cut(s) 183
MluCI AATT 3 cut(s) 64, 112, 183
MmeI TCCRAC 1 cut(s) 295
MnlI CCTC 6 cut(s) 155, 359, 372, 404, 410, 416
MspA1I CMGCKG 1 cut(s) 265
MspI CCGG 1 cut(s) 361
MspR9I CCNGG 2 cut(s) 127, 144
MunI CAATTG 1 cut(s) 183
MvaI CCWGG 2 cut(s) 127, 144
MwoI GCNNNNNNNGC 2 cut(s) 173, 197
NdeII GATC 1 cut(s) 30
NlaIV GGNNCC 2 cut(s) 261, 359
NmeAIII GCCGAG 1 cut(s) 51
NmuCI GTSAC 1 cut(s) 85
PceI AGGCCT 1 cut(s) 142
PcsI WCGNNNNNNNCGW 1 cut(s) 303
PflFI GACNNNGTC 1 cut(s) 305
PkrI GCNGC 2 cut(s) 267, 293
Psp6I CCWGG 2 cut(s) 125, 142
PspFI CCCAGC 1 cut(s) 191
PspGI CCWGG 2 cut(s) 125, 142
PspN4I GGNNCC 2 cut(s) 261, 359
PspPI GGNCC 1 cut(s) 260
PstI CTGCAG 1 cut(s) 106
PsyI GACNNNGTC 1 cut(s) 305
SatI GCNGC 2 cut(s) 266, 292
Sau3AI GATC 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 260
ScrFI CCNGG 2 cut(s) 127, 144
SetI ASST 7 cut(s) 39, 85, 131, 293, 370, 383, 427
SfaNI GCATC 2 cut(s) 178, 343
SfcI CTRYAG 1 cut(s) 102
SinI GGWCC 1 cut(s) 260
Sse9I AATT 3 cut(s) 64, 112, 183
SseBI AGGCCT 1 cut(s) 142
SsiI CCGC 2 cut(s) 167, 263
SspMI CTAG 1 cut(s) 117
StuI AGGCCT 1 cut(s) 142
StyD4I CCNGG 2 cut(s) 125, 142
StyI CCWWGG 1 cut(s) 76
TaaI ACNGT 2 cut(s) 276, 307
TasI AATT 3 cut(s) 64, 112, 183
TseFI GTSAC 1 cut(s) 85
TseI GCWGC 2 cut(s) 265, 291
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 3 cut(s) 17, 60, 336
Tth111I GACNNNGTC 1 cut(s) 305
VpaK11BI GGWCC 1 cut(s) 260
XapI RAATTY 1 cut(s) 64
XspI CTAG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.