Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7B

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

15200637 .. 15208222

Gene Structure 7586 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7BG188800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 453 bp

ATGGAGATCCAAGCTTTGAATCCCAACTGCAACAACCACAATGACTACTGTATAATCGTGACGGCTGCAGATATAGAGATCATTGCTGGTGATCCAGAATGTGTTAGTGAGACATGGATGAGTAATGTATATAGTTTGGGGATGGTGATTTGGGAGATGGTGACTGGTGAGGCAGCCTACTCCGCATGTTCACCGATCCAAGTAGCAGTTGGGATAGTTGCATGTGGCCTCAGACCTGAGATTCTAAAGGACTGTCCACAAATGCTGAGATCCTTGATGACCAAGTGCTGGAACAACTCCCCCTCAAAGCGTCCTCAGTTCTCTGAAATTCTATCACTATTGCTGCGGACCAAAAACAATGTCATGGATGACATGCATGACTATAAAAACAAAGCTAAATACCAACACCTATATCAAAATCCACAAAAGCCCTTGGTCGATCACAACAATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0035556 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase_Tyr

Protein Analysis

150

Amino Acids

16.96

Weight (kDa)

5.48

Isoelectric Point (pI)

62.62

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PK_Tyr_Ser-Thr	PF07714	38 - 113	3.2e-15	Protein tyrosine and serine/threonine kinase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	288
AciI	CCGC	2 cut(s)	183, 346
AclWI	GGATC	3 cut(s)	86, 190, 264
AcsI	RAATTY	1 cut(s)	327
AfiI	CCNNNNNNNGG	1 cut(s)	288
AgsI	TTSAA	1 cut(s)	19
AluBI	AGCT	2 cut(s)	14, 395
AluI	AGCT	2 cut(s)	14, 395
Alw26I	GTCTC	1 cut(s)	104
AlwI	GGATC	3 cut(s)	86, 190, 264
AoxI	GGCC	1 cut(s)	226
ApeKI	GCWGC	3 cut(s)	65, 173, 343
ApoI	RAATTY	1 cut(s)	327
ArsI	GACNNNNNNTTYG	2 cut(s)	345, 377
AspS9I	GGNCC	1 cut(s)	348
AsuHPI	GGTGA	5 cut(s)	101, 157, 172, 179, 183
AvaII	GGWCC	1 cut(s)	348
BbvI	GCAGC	3 cut(s)	52, 185, 330
BccI	CCATC	2 cut(s)	136, 151
BceAI	ACGGC	1 cut(s)	78
BcoDI	GTCTC	1 cut(s)	104
BfmI	CTRYAG	1 cut(s)	66
BisI	GCNGC	3 cut(s)	66, 174, 344
BlsI	GCNGC	3 cut(s)	67, 175, 345
Bme18I	GGWCC	1 cut(s)	348
BmgT120I	GGNCC	1 cut(s)	348
BsaJI	CCNNGG	1 cut(s)	432
Bsc4I	CCNNNNNNNGG	1 cut(s)	288
Bse1I	ACTGG	1 cut(s)	169
Bse3DI	GCAATG	1 cut(s)	81
BseDI	CCNNGG	1 cut(s)	432
BseGI	GGATG	3 cut(s)	123, 147, 373
BseLI	CCNNNNNNNGG	1 cut(s)	288
BseMI	GCAATG	1 cut(s)	81
BseMII	CTCAG	4 cut(s)	228, 244, 257, 329
BseNI	ACTGG	1 cut(s)	169
BseXI	GCAGC	3 cut(s)	52, 185, 330
BshFI	GGCC	1 cut(s)	228
BslI	CCNNNNNNNGG	1 cut(s)	288
BsmAI	GTCTC	1 cut(s)	104
BsnI	GGCC	1 cut(s)	228
Bsp143I	GATC	6 cut(s)	6, 78, 91, 195, 269, 439
BspACI	CCGC	2 cut(s)	183, 346
BspANI	GGCC	1 cut(s)	228
BspCNI	CTCAG	4 cut(s)	229, 243, 258, 328
BspMAI	CTGCAG	1 cut(s)	70
BspPI	GGATC	3 cut(s)	86, 190, 264
BsrDI	GCAATG	1 cut(s)	81
BsrI	ACTGG	1 cut(s)	169
BssECI	CCNNGG	1 cut(s)	432
BssMI	GATC	6 cut(s)	6, 78, 91, 195, 269, 439
BssT1I	CCWWGG	1 cut(s)	432
Bst4CI	ACNGT	2 cut(s)	50, 254
BstDEI	CTNAG	4 cut(s)	230, 237, 266, 315
BstF5I	GGATG	3 cut(s)	123, 147, 373
BstKTI	GATC	6 cut(s)	9, 81, 94, 198, 272, 442
BstMAI	GTCTC	1 cut(s)	104
BstMBI	GATC	6 cut(s)	6, 78, 91, 195, 269, 439
BstMWI	GCNNNNNNNGC	1 cut(s)	182
BstNSI	RCATGY	3 cut(s)	189, 225, 376
BstSFI	CTRYAG	1 cut(s)	66
BstV1I	GCAGC	3 cut(s)	52, 185, 330
BstX2I	RGATCY	2 cut(s)	6, 269
BstYI	RGATCY	2 cut(s)	6, 269
BsuRI	GGCC	1 cut(s)	228
BtsCI	GGATG	3 cut(s)	123, 147, 373
Cfr13I	GGNCC	1 cut(s)	348
CseI	GACGC	1 cut(s)	299
CviAII	CATG	6 cut(s)	114, 186, 222, 364, 373, 377
CviJI	RGCY	6 cut(s)	14, 65, 176, 228, 395, 430
CviKI_1	RGCY	6 cut(s)	14, 65, 176, 228, 395, 430
DdeI	CTNAG	4 cut(s)	230, 237, 266, 315
DpnI	GATC	6 cut(s)	8, 80, 93, 197, 271, 441
DpnII	GATC	6 cut(s)	6, 78, 91, 195, 269, 439
Eco130I	CCWWGG	1 cut(s)	432
Eco47I	GGWCC	1 cut(s)	348
EcoT14I	CCWWGG	1 cut(s)	432
EcoT22I	ATGCAT	1 cut(s)	378
ErhI	CCWWGG	1 cut(s)	432
FaeI	CATG	6 cut(s)	117, 189, 225, 367, 376, 380
FatI	CATG	6 cut(s)	113, 185, 221, 363, 372, 376
Fnu4HI	GCNGC	3 cut(s)	66, 174, 344
FokI	GGATG	3 cut(s)	130, 154, 380
Fsp4HI	GCNGC	3 cut(s)	66, 174, 344
GluI	GCNGC	3 cut(s)	66, 174, 344
HaeIII	GGCC	1 cut(s)	228
HgaI	GACGC	1 cut(s)	299
Hin1II	CATG	6 cut(s)	117, 189, 225, 367, 376, 380
HindIII	AAGCTT	1 cut(s)	12
HinfI	GANTC	2 cut(s)	19, 241
HphI	GGTGA	5 cut(s)	101, 157, 172, 179, 183
Hpy166II	GTNNAC	2 cut(s)	191, 257
Hpy188I	TCNGA	2 cut(s)	233, 325
Hpy188III	TCNNGA	2 cut(s)	58, 95
Hpy8I	GTNNAC	2 cut(s)	191, 257
HpyCH4III	ACNGT	2 cut(s)	50, 254
HpyCH4V	TGCA	4 cut(s)	30, 68, 221, 376
HpyF10VI	GCNNNNNNNGC	1 cut(s)	182
HpyF3I	CTNAG	4 cut(s)	230, 237, 266, 315
Hsp92II	CATG	6 cut(s)	117, 189, 225, 367, 376, 380
Kzo9I	GATC	6 cut(s)	6, 78, 91, 195, 269, 439
LpnPI	CCDG	5 cut(s)	72, 108, 150, 249, 274
Lsp1109I	GCAGC	3 cut(s)	52, 185, 330
MaeIII	GTNAC	2 cut(s)	58, 160
MalI	GATC	6 cut(s)	8, 80, 93, 197, 271, 441
MboI	GATC	6 cut(s)	6, 78, 91, 195, 269, 439
MflI	RGATCY	2 cut(s)	6, 269
MluCI	AATT	2 cut(s)	327, 448
MnlI	CCTC	4 cut(s)	163, 239, 313, 324
Mph1103I	ATGCAT	1 cut(s)	378
MseI	TTAA	1 cut(s)	451
MwoI	GCNNNNNNNGC	1 cut(s)	182
NdeII	GATC	6 cut(s)	6, 78, 91, 195, 269, 439
NlaIII	CATG	6 cut(s)	117, 189, 225, 367, 376, 380
NmuCI	GTSAC	2 cut(s)	58, 160
NsiI	ATGCAT	1 cut(s)	378
NspI	RCATGY	3 cut(s)	189, 225, 376
PfeI	GAWTC	2 cut(s)	19, 241
PflMI	CCANNNNNTGG	1 cut(s)	288
PkrI	GCNGC	3 cut(s)	67, 175, 345
PspPI	GGNCC	1 cut(s)	348
PstI	CTGCAG	1 cut(s)	70
PsuI	RGATCY	2 cut(s)	6, 269
SaqAI	TTAA	1 cut(s)	451
SatI	GCNGC	3 cut(s)	66, 174, 344
Sau3AI	GATC	6 cut(s)	6, 78, 91, 195, 269, 439
Sau96I	GGNCC	1 cut(s)	348
SetI	ASST	4 cut(s)	16, 238, 397, 411
SfcI	CTRYAG	1 cut(s)	66
SinI	GGWCC	1 cut(s)	348
Sse9I	AATT	2 cut(s)	327, 448
SsiI	CCGC	2 cut(s)	183, 346
StyI	CCWWGG	1 cut(s)	432
TaaI	ACNGT	2 cut(s)	50, 254
TaqI	TCGA	1 cut(s)	438
TasI	AATT	2 cut(s)	327, 448
TfiI	GAWTC	2 cut(s)	19, 241
Tru1I	TTAA	1 cut(s)	451
Tru9I	TTAA	1 cut(s)	451
TseFI	GTSAC	2 cut(s)	58, 160
TseI	GCWGC	3 cut(s)	65, 173, 343
Tsp45I	GTSAC	2 cut(s)	58, 160
Van91I	CCANNNNNTGG	1 cut(s)	288
VpaK11BI	GGWCC	1 cut(s)	348
XapI	RAATTY	1 cut(s)	327
XceI	RCATGY	3 cut(s)	189, 225, 376
XcmI	CCANNNNNNNNNTGG	1 cut(s)	206
Zsp2I	ATGCAT	1 cut(s)	378

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.