Rh7BG468900

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
N/A
Physical Location & Seq
Forward (+)
55444870 .. 55446672
1803 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG468900.1

Sequence Viewer

Length: 210 bp
ATGCAACAATTGAAATCTCTAAGTTTTGAAAGTTGCAAATTCCTAACAGAGGTCCCCGACTTATCTGGAATGTTTCCAAAGTTGGAGAGTTTGAATTTAAGAGGGGATAGCTGCAAAACAGAGGACGACTTTTTTCGGAATTTAGACCGGGACTATGACAGCAAGTGGGCGAATAGCTCAAGAGAAGAAGGGCCGTCAGGGTGGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.96

Weight (kDa)

4.62

Isoelectric Point (pI)

59.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 38, 94, 139
AfiI CCNNNNNNNGG 1 cut(s) 49
AgsI TTSAA 3 cut(s) 13, 29, 94
AluBI AGCT 2 cut(s) 111, 177
AluI AGCT 2 cut(s) 111, 177
AoxI GGCC 1 cut(s) 191
ApeKI GCWGC 1 cut(s) 111
ApoI RAATTY 3 cut(s) 38, 94, 139
AspS9I GGNCC 2 cut(s) 52, 191
AsuC2I CCSGG 1 cut(s) 149
AvaII GGWCC 1 cut(s) 52
BbvI GCAGC 1 cut(s) 98
BceAI ACGGC 1 cut(s) 178
BcnI CCSGG 1 cut(s) 149
BisI GCNGC 1 cut(s) 112
BlsI GCNGC 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 2 cut(s) 52, 191
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 149
BpuEI CTTGAG 1 cut(s) 163
BpuMI CCSGG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 49
BseXI GCAGC 1 cut(s) 98
BshFI GGCC 1 cut(s) 193
BsiSI CCGG 1 cut(s) 148
BslFI GGGAC 2 cut(s) 38, 164
BslI CCNNNNNNNGG 1 cut(s) 49
BsmFI GGGAC 2 cut(s) 38, 164
BsnI GGCC 1 cut(s) 193
BspANI GGCC 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 20
BstENI CCTNNNNNAGG 1 cut(s) 47
BstSCI CCNGG 1 cut(s) 147
BstV1I GCAGC 1 cut(s) 98
BsuRI GGCC 1 cut(s) 193
Cfr13I GGNCC 2 cut(s) 52, 191
CviJI RGCY 3 cut(s) 111, 177, 193
CviKI_1 RGCY 3 cut(s) 111, 177, 193
DdeI CTNAG 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 52
EcoNI CCTNNNNNAGG 1 cut(s) 47
EcoO109I RGGNCCY 1 cut(s) 52
FaiI YATR 2 cut(s) 156, 208
FaqI GGGAC 2 cut(s) 38, 164
Fnu4HI GCNGC 1 cut(s) 112
Fsp4HI GCNGC 1 cut(s) 112
GluI GCNGC 1 cut(s) 112
HaeIII GGCC 1 cut(s) 193
HapII CCGG 1 cut(s) 148
HpaII CCGG 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 138
Hpy188III TCNNGA 2 cut(s) 66, 180
HpyAV CCTTC 1 cut(s) 182
HpyCH4V TGCA 3 cut(s) 4, 36, 114
HpyF3I CTNAG 1 cut(s) 20
LpnPI CCDG 3 cut(s) 51, 161, 183
Lsp1109I GCAGC 1 cut(s) 98
MboII GAAGA 1 cut(s) 197
MfeI CAATTG 1 cut(s) 8
MluCI AATT 4 cut(s) 8, 38, 94, 139
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 3 cut(s) 43, 95, 115
MseI TTAA 1 cut(s) 98
MspI CCGG 1 cut(s) 148
MspR9I CCNGG 1 cut(s) 149
MunI CAATTG 1 cut(s) 8
NciI CCSGG 1 cut(s) 149
NlaIV GGNNCC 1 cut(s) 54
PkrI GCNGC 1 cut(s) 113
PpuMI RGGWCCY 1 cut(s) 52
Psp5II RGGWCCY 1 cut(s) 52
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 2 cut(s) 52, 191
PspPPI RGGWCCY 1 cut(s) 52
SaqAI TTAA 1 cut(s) 98
SatI GCNGC 1 cut(s) 112
Sau96I GGNCC 2 cut(s) 52, 191
ScrFI CCNGG 1 cut(s) 149
SetI ASST 3 cut(s) 54, 113, 179
SgeI CNNG 6 cut(s) 68, 78, 160, 161, 175, 192
SinI GGWCC 1 cut(s) 52
SmlI CTYRAG 1 cut(s) 178
SmoI CTYRAG 1 cut(s) 178
Sse9I AATT 4 cut(s) 8, 38, 94, 139
StyD4I CCNGG 1 cut(s) 147
TasI AATT 4 cut(s) 8, 38, 94, 139
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TseI GCWGC 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 52
XagI CCTNNNNNAGG 1 cut(s) 47
XapI RAATTY 3 cut(s) 38, 94, 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.