Rh7CG199600

Leucine-rich repeat receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
N/A
Physical Location & Seq
Forward (+)
17724781 .. 17730248
5468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG199600.1

Sequence Viewer

Length: 396 bp
ATGCAATCCCATTTTGAGTTTGAACTCAGATTTGAAATGTTGTTTGACAGGGCAATCATGATGGGCCTGATGCTTCATACCAATAATTGGTTCACAGAAGAAAGAAGCTCCAAAGAAGAAGATGGATTCAACCAAAACCCTTACAAGTGTGCAGAAACAAAAGGTATCAAGGTTGATAATGTAATCTCCTGTCTTCCTAAGCTGCTTGCTGATGACAATGTCTTCTGCACTCTGGAAACAAGTGCTGCAACGGGATACTTAGCTCCTGAATATATCACAACTGATATCAAGAATTCGTCGACAAAACCTAAAAGGGCAATTCTAGAACCTGAAGCAGCTGCAACGGGAAATCCATTCAGGCAGCCACCAATCTGGTCCTATCGCCTCAACCTTTAA

Protein Analysis

131

Amino Acids

15.0

Weight (kDa)

5.19

Isoelectric Point (pI)

37.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 87
AccI GTMKAC 1 cut(s) 299
AcsI RAATTY 1 cut(s) 292
AcuI CTGAAG 1 cut(s) 351
AfiI CCNNNNNNNGG 1 cut(s) 87
AgsI TTSAA 3 cut(s) 23, 35, 130
AjuI GAANNNNNNNTTGG 2 cut(s) 74, 106
AluBI AGCT 4 cut(s) 108, 202, 263, 338
AluI AGCT 4 cut(s) 108, 202, 263, 338
AoxI GGCC 1 cut(s) 64
ApeKI GCWGC 5 cut(s) 202, 245, 335, 338, 361
ApoI RAATTY 1 cut(s) 292
AspS9I GGNCC 2 cut(s) 64, 375
AvaII GGWCC 1 cut(s) 375
BbsI GAAGAC 2 cut(s) 185, 214
BbvI GCAGC 5 cut(s) 189, 232, 325, 347, 373
BccI CCATC 2 cut(s) 55, 116
BciVI GTATCC 1 cut(s) 248
BfaI CTAG 1 cut(s) 323
BfuI GTATCC 1 cut(s) 248
BisI GCNGC 5 cut(s) 203, 246, 336, 339, 362
BlsI GCNGC 5 cut(s) 204, 247, 337, 340, 363
Bme18I GGWCC 1 cut(s) 375
BmgT120I GGNCC 2 cut(s) 64, 375
BmsI GCATC 1 cut(s) 60
BpiI GAAGAC 2 cut(s) 185, 214
Bpu10I CCTNAGC 1 cut(s) 198
Bsc4I CCNNNNNNNGG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 40
BseXI GCAGC 5 cut(s) 189, 232, 325, 347, 373
BsgI GTGCAG 2 cut(s) 171, 211
BshFI GGCC 1 cut(s) 66
BslI CCNNNNNNNGG 1 cut(s) 87
BsnI GGCC 1 cut(s) 66
BspANI GGCC 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 39
BspHI TCATGA 1 cut(s) 57
BstC8I GCNNGC 1 cut(s) 207
BstDEI CTNAG 3 cut(s) 26, 198, 259
BstV1I GCAGC 5 cut(s) 189, 232, 325, 347, 373
BstV2I GAAGAC 2 cut(s) 185, 214
BstXI CCANNNNNNTGG 1 cut(s) 372
BsuI GTATCC 1 cut(s) 248
BsuRI GGCC 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 207
CciI TCATGA 1 cut(s) 57
Cfr13I GGNCC 2 cut(s) 64, 375
CviAII CATG 1 cut(s) 58
CviJI RGCY 6 cut(s) 66, 108, 202, 263, 338, 364
CviKI_1 RGCY 6 cut(s) 66, 108, 202, 263, 338, 364
DdeI CTNAG 3 cut(s) 26, 198, 259
Eco32I GATATC 1 cut(s) 286
Eco47I GGWCC 1 cut(s) 375
Eco57I CTGAAG 1 cut(s) 351
EcoRI GAATTC 1 cut(s) 292
EcoRV GATATC 1 cut(s) 286
FaeI CATG 1 cut(s) 61
FaiI YATR 3 cut(s) 59, 78, 273
FatI CATG 1 cut(s) 57
FblI GTMKAC 1 cut(s) 299
Fnu4HI GCNGC 5 cut(s) 203, 246, 336, 339, 362
Fsp4HI GCNGC 5 cut(s) 203, 246, 336, 339, 362
FspBI CTAG 1 cut(s) 323
GluI GCNGC 5 cut(s) 203, 246, 336, 339, 362
HaeIII GGCC 1 cut(s) 66
Hin1II CATG 1 cut(s) 61
HincII GTYRAC 1 cut(s) 300
HindII GTYRAC 1 cut(s) 300
HinfI GANTC 1 cut(s) 126
Hpy166II GTNNAC 2 cut(s) 93, 300
Hpy188I TCNGA 1 cut(s) 29
Hpy188III TCNNGA 5 cut(s) 58, 233, 266, 289, 323
Hpy8I GTNNAC 2 cut(s) 93, 300
Hpy99I CGWCG 1 cut(s) 301
HpyCH4V TGCA 5 cut(s) 4, 152, 228, 248, 341
HpyF3I CTNAG 3 cut(s) 26, 198, 259
Hsp92II CATG 1 cut(s) 61
LmnI GCTCC 2 cut(s) 113, 268
LpnPI CCDG 8 cut(s) 34, 80, 202, 218, 279, 342, 343, 358
Lsp1109I GCAGC 5 cut(s) 189, 232, 325, 347, 373
LweI GCATC 1 cut(s) 60
MaeI CTAG 1 cut(s) 323
MboII GAAGA 5 cut(s) 110, 128, 131, 185, 214
MluCI AATT 3 cut(s) 85, 292, 318
MnlI CCTC 1 cut(s) 395
MseI TTAA 1 cut(s) 394
MspA1I CMGCKG 1 cut(s) 338
NlaIII CATG 1 cut(s) 61
PagI TCATGA 1 cut(s) 57
PfeI GAWTC 1 cut(s) 126
PflFI GACNNNGTC 1 cut(s) 218
PflMI CCANNNNNTGG 1 cut(s) 87
PkrI GCNGC 5 cut(s) 204, 247, 337, 340, 363
PspPI GGNCC 2 cut(s) 64, 375
PsyI GACNNNGTC 1 cut(s) 218
PvuII CAGCTG 1 cut(s) 338
SalI GTCGAC 1 cut(s) 298
SaqAI TTAA 1 cut(s) 394
SatI GCNGC 5 cut(s) 203, 246, 336, 339, 362
Sau96I GGNCC 2 cut(s) 64, 375
SetI ASST 9 cut(s) 110, 166, 174, 204, 265, 310, 331, 340, 393
SfaNI GCATC 1 cut(s) 60
SinI GGWCC 1 cut(s) 375
Sse9I AATT 3 cut(s) 85, 292, 318
SspMI CTAG 1 cut(s) 323
TaqI TCGA 1 cut(s) 299
TasI AATT 3 cut(s) 85, 292, 318
TfiI GAWTC 1 cut(s) 126
Tru1I TTAA 1 cut(s) 394
Tru9I TTAA 1 cut(s) 394
TseI GCWGC 5 cut(s) 202, 245, 335, 338, 361
TspDTI ATGAA 1 cut(s) 65
Tth111I GACNNNGTC 1 cut(s) 218
Van91I CCANNNNNTGG 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 375
XapI RAATTY 1 cut(s) 292
XbaI TCTAGA 1 cut(s) 322
XmiI GTMKAC 1 cut(s) 299
XspI CTAG 1 cut(s) 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.